TABLE 1.

Summary of BFV small RNAs recovered from chronically BFV-infected MDBK cells^a

miRNA	Sequence	Length (nt)	Start position	End position	No. of reads	% of reads
miR-BF1-5p	UUCGGAGGAUGGCUCAUCAAGC	22	11,190	11,211	878,086	32
	UUCGGAGGAUGGCUCAUCAAGCU	23	11,190	11,212	836,116	30
	UUCGGAGGAUGGCUCAUCAAG	21	11,190	11,210	659,169	24
	UUCGGAGGAUGGCUCAUCAAGCC	23	11,190	11,212	127,154	5
miR-BF1-3p	UCCCUGAAGCCAUAUCCGAGGC	22	11,224	11,245	86,127	58
	UCCCUGAAGCCAUAUCCGAGG	21	11,224	11,244	28,224	19
	UCCCUGAAGCCAUAUCCGAGGU	22	11,224	11,245	6,142	4
	UCCCUGAAGCCAUAUCCGAGGCU	23	11,224	11,246	3,400	2
	UCCCUGAAGCCAUAUCCGAGGCA	23	11,224	11,246	3,185	2
miR-BF2-5p	UCAGUAGAAAGACAGUACCUCGCC	24	11,246	11,269	3,514,215	47
	UCAGUAGAAAGACAGUACCUCGCCU	25	11,246	11,270	2,052,969	28
	UCAGUAGAAAGACAGUACCUCGCCC	25	11,246	11,270	384,581	5
	UCAGUAGAAAGACAGUACCUCGC	23	11,246	11,268	369,154	5
	UCAGUAGAAAGACAGUACCUCGCCUGU	27	11,246	11,272	301,059	4
miR-BF2-3p	CCAGGCGGUAUGCUUUCUACU	21	11,285	11,305	35	58
	CCAGGCGGUAUGCUUUCUACUU	22	11,285	11,306	11	18
	UCAGGCGGUAUGCUUUCUACU	21	11,285	11,305	3	5
	CCAGGCGGUAUGCUUUCUAC	20	11,285	11,304	2	3
	CCAGGCGGUAUGCUUUCUACUUUU	24	11,285	11,308	2	3

^aRNA species that contributed ≥2% of the total reads for a given BFV miRNA are shown, with their positions relative to the reference BFV strain (accession no. JX307862.1) indicated by genome coordinates. Nontemplated nucleotides are indicated in bold.