Figure 2.
Identification of ABHD5 large deletion. A) Diagram of the large deletion identified in Brasilian patient. Normal sequence of ABHD5 and promoter region is aligned with the deleted sequence. B) Scheme of rearrangement: deletion removes 3454 bp of the promoter sequence, exon 1 and 331 bp of the intron 1. DNA repair was accompanied by an insertion of 26 bp (GCTGTCTGAAACCTTAGGATTTTGCA), indicated by a dashed line, where the DNA breakpoints rejoined. Electropherogram of ABHD5 gene deletion in CDS patient is shown below the scheme. C) Schematic representation of the promoter region identified at 0.3 kb from the ATG start codon with all transcription factors. D) ABHD5 expression evaluated by comparative RT-PCR. Picture of gel shows lack of ABHD5 mRNA in the affected proband. M: 100-bp molecular weight marker. Lane I: control. Lane II: CDS patient. Lane III: father. Lane IV: mother.