Table 1. Primers used in this study.
| Primer name | Target | Sequence (5′–3′) | Sizea | Useb |
|---|---|---|---|---|
| MIL-6F | mIL-6 gene | CATGTTCTCTGGGAAATCGTGG | 474 bp | RT-PCR of the IL-6 gene |
| MIL-6R | AACGCACTAGGTTTGCCGAGTA | |||
| QMIL-6F QMIL-6R | mIL-6 gene fragment | CTCTGGGA AATCGTGGAAATG AAGTGCATCATCGTTGTTCATACA | 75 bp | qRT-PCR (IL-6 transcript levels) |
| QBACTF QBACTR | β-actin gene fragment | ACCAACTGGGACGACATGGAGAA GTGGTGGTGAAGCTGTAGCC | 380 bp | qRT-PCR (cDNA reference control) |
| CSLF CSLR | CSL-containing region of the mil-6 gene | TCGATGCTAAACGACGTCAC TCAATTCCAGAAACCGCTATG | 230 bp | qPCR detection of CSL-bound DNA (ChIP assay) |
a
Expected amplicon size in bp using these primer pairs.
b
Application of these primer pairs in this report.
Abbreviations: ChIP, chromatin immunoprecipitation; CSL, CBF1/Su(H)/Lag-1; qPCR, quantitative PCR; qRT-PCR, quantitative PCR with reverse transcription.