TABLE 1.
Bacterial strains, plasmids, and oligonucleotides
| Strain, plasmid, or primer | Genotype, phenotype, or sequence (5′-3′) and description | Reference or origin |
|---|---|---|
| Strains | ||
| P. aeruginosa | ||
| PAO1 | Wild type | ATCC 15692 |
| PAO6281 | gacA::Ω-Sp/Sm | 45 |
| PAO6327 | gacS::Ω-Sp/Sm | C. Reimmann, unpublished data |
| PAO6343 | ΔrsmA, gacA′::Ω-Sp/Sm | This study |
| PAO6354 | ΔrsmZ | This study |
| PAO6385 | ΔrsmZ, gacA′::Ω-Sp/Sm | This study |
| PAZH13 | ΔrsmA | 43 |
| PT712 | rhlA::Ω-Gm | 24 |
| E. coli | ||
| DH5α | F−endA1 hsdR17 supE44 thi-1 recA1 gyrA96 relA1 Δ(lacZYA-argF)U169 deoR λ(φ80dlacZΔM15) | 48 |
| S17-1 | pro thi hsdR recA Tpr Smr; chromosome::RP4-2 Tc::Mu-Km::Tn7 | 49 |
| Plasmids | ||
| pBLS-II KS | Cloning vector; ColE1 replicon, Apr | Stratagene |
| pDB18R | pTZ18R, rpoS, Apr | 54 |
| pECP60 | rhlA′-′lacZ translational fusion on pSW205, Apr | 40 |
| pME3087 | Suicide vector, polylinker of pMMB67, ColE1-replicon, Tcr | 56 |
| pME3280b | Mini-Tn7 gene delivery vector based on pUX-BF5 with a HindIII-PstI-MluI-SpeI MCS, ColE1-replicon Gmr Apr | 64 |
| pME3328 | pBLS-II KS, with a 1.43-kb BamHI-XhoI fragment containing ′rpoS rsmZ and ′fdxA, Apr | This study |
| pME3331 | pME6016 derivative, containing the rsmZ promoter fused at +1 to lacZ, Tcr | This study |
| pME3332 | pME3087 carrying a 1.15-kb KpnI-BamHI ′rpoS-′fdxA insert with a 250-bp deletion in rsmZ, Tcr | This study |
| pME3337.1 | pME6000, with a 1.1-kb EcoRI-BamHI fragment of pME3328 containing rsmZ, Tcr | This study |
| pME3337.3 | pME6001, with a 1.1-kb EcoRI-BamHI fragment of pME3328 containing rsmZ, Gmr | This study |
| pME3838 | pME6016 derivative, containing the rhlA promoter fused 2 bp after the +1 site to lacZ, Tcr | This study |
| pME3839 | pME6032 carrying the rhlAB genes under Ptac control, Tcr | This study |
| pME3849 | pME6001 with rsmA, Gmr | 43 |
| pME6000 | Cloning vector derived from pBRR1MCS, Tcr | 31 |
| pME6001 | Cloning vector derived from pME6000, Gmr | 16 |
| pME6016 | Cloning vector for transcriptional lacZ fusions, pVS1-p15A replicon, Tcr | 18 |
| pME6032 | Cloning vector for overexpression under the IPTG-inducible tac promoter, Tcr | 16 |
| pME6111 | pME3088 suicide vector carrying a 4.8-kb EcoRI-KpnI fragment with gacA::ΩSm/Sp, Tcr, Cmr | 45 |
| pME6313 | Mini-Tn7 gene delivery vector based on pUX-BF5 with a HindIII-PstI-SmaI-SpeI MCS, Gmr Apr | H. Winteler and D. Haas, unpublished data |
| pSB536 | AHL biosensor, ahyR"-luxCDABE in pAHP13, Apr | 53 |
| pSB1075 | AHL reporter plasmid, P. aeruginosa lasRI fused with luxCDABE from Photorhabdus luminescens, Apr | 60 |
| Primers | ||
| DS5-EcoRI | AAAAGAATTCCAATACCACCAACC, with an underlined EcoRI restriction site, located in rhlA promoter | |
| DS6-PstI | AAAACTGCAGATGAACACTTTTTAGCC, with an underlined PstI restriction site, annealing to the +1 site (bold) region of rhlA | |
| RhlAB-KH3 | AAAAGAATTCATGCGGCGCGAAAGTC, with an underlined EcoRI restriction site, located in the start codon (bold) region of rhlA | |
| RhlAB-KH4 | CCCTGATCGATAAAATGC, with an underlined ClaI restriction site, located 108 bp after the stop codon of rhlB | |
| PRSMPAO1 | CCCTGTACGCTGCAGTGATATTAGCGATTCCC, with an underlined PstI restriction site, located in rsmZ promoter (Fig. 3) | |
| PRSMPAO2 | AAACGCTCGGTGAATTCAAGTAACTTATTG, located in rsmZ promoter region (Fig. 3) | |
| PRSMPAO4 | GATGAATTCTCGAGGATCAATC, with an underlined XhoI restriction site, located upstream of fdxA | |
| PRSMPAO7 | GGCCTCTCGAGTGACGCGCTGTTCC, with an underlined XhoI restriction site, located at the 3′ end of rpoS (Fig. 3) | |
| PRSMPAO8 | AATAAGCTTAATGCTTACAAGAGCAGACAC, with an underlined HindIII restriction site, located in the upstream activation sequence of rsmZ (Fig. 3) | |
| PRSMPAO9 | AATAAGCTTAGGGACTGAAGAGTGGGCGG, with an underlined HindIII restriction site, located 75 bp after rsmZ start (Fig. 3) | |
| PRSMZ1 | CGTACAGGGAACACGCAACC, corresponding to the +1 and the first 20 bases of rsmZ gene | |
| PRSMZ2 | AAAAAAAGGGGCGGGGTATT, located in the terminator of rsmZ gene |