Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in GATA2 sequencing
| Exon | Forward primer | Reverse primer | PCR size |
|---|---|---|---|
| e1 |
tcctttcgttttgagccttg |
ttttcagcagctcgattcct |
552 |
| e2 |
ctggttctgggagtcgtgat |
catcttcatgctctccgtca |
542 |
| “” |
ggaggcccactctctgtgta |
cctctcccaagtcacagctc |
548 |
| e3 |
agaccctctcgtccctcttc |
agacgaccccaactgacatc |
464 |
| e4 |
cttgcaatcccgttgattct |
agccaagctggatattgtgg |
466 |
| e5 | ctatgaaggtcgggcacaat | gtcctcgacgtccatctgtt | 457 |
