Table 2.
List of genes and primer sequences.
| Gene | ID | NCBI reference sequence | Official symbol | Forward primer sequence (5′-3′) |
Reverse primer sequence (5′-3′) |
|---|---|---|---|---|---|
| Glyceraldehyde-3-phosphate dehydrogenase | 24383 | NC_005103.3 | GAPDH | aaggggaacccttgatatgg | cggagatgatgacccttttg |
| Tumor necrosis factor | 24835 | NC_005119.3 | TNF-α | gctgaggttggacggataaa | aaaatcctgccctgtcacac |
| Interleukin 6 | 24499 | NC_005103.3 | IL6 | caaaagagagcctgggactg | ggctgaagaattgctggaag |
| Plasminogen-activator inhibitor type 1 | 24617 | NC_005111.3 | PAI-I | gatctcctgggatcactcca | ttgggggatgtctacatggt |
| Adiponectin | 246253 | NC_005110.3 | Adipoq | gacaaggccgttctcttcac | gtccccttccccatacactt |