Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Primers | Sequence |
|---|---|
| Domain I | |
| Forward primer | ggcggaattcgatgcacacaagag |
| Reverse primer | atttgcggccgctctctgtttggc |
| Domain II | |
| Forward primer | agcagaattcgggaaggcttcgtct |
| Reverse primer | ataatgcggccgcctgaggctcttc |
| Domain III | |
| Forward primer | agacgaattcgtggaagagcctcag |
| Reverse primer | tatagcggccgcttataagcctaa |
