Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequence of primers used in this study.
| AGI number | Forward primer sequence (5′-3′) | Reverse primer sequence (5′-3′) | Purpose |
|---|---|---|---|
| At2g36990 (SIG6) | ctctggagaggaggcagtttg | gccggcaatttcgtttcagat | qRT-PCR analysis |
| At2g20570 (GLK1) | tcattttaggcccctgcatgt | ggattaggcatggcggtagaa | qRT-PCR analysis |
| At5g44190 (GLK2) | aacctaaggtggattggacgc | tttccaagattcgagacggca | qRT-PCR analysis |
| At5g25760 (UBC21) | caaatggaccgctcttatcaaag | ctgaaaaacaccgccttcgt | qRT-PCR analysis |
