. 2014 Apr 22;15(4):7029–7036. doi: 10.3390/ijms15047029

Table 3.

Primer sets used for the identification of single nucleotide polymorphisms (SNPs) in the growth hormone (GH) gene in S. chuatsi.

Primer name	The size of the fragment (bp)	Primer sequence (5′–3′)	Location along the gene	Amplified gene frament	Annealing temperature (°C)
G1	465	F: GCAACCCGATGAGAAATA	163–627	Part of intron 2, exon 2, part of intron 3	55
G1	465	R: CTCTGCGAGCTGCTGTAA	163–627	Part of intron 2, exon 2, part of intron 3	55
G2	919	F: GGAAAGGCAGAATGGATG	3111–4029	Part of intron 3, exon 3, part of intron 4	55
G2	919	R: GAGGCTCAGATGATTGTTGGTC	3111–4029	Part of intron 3, exon 3, part of intron 4	55
G3	516	F: GAGTTTCCCAGTCGTTCT	4827–5342	Part of exon 4, intron 4, exon 5, intron 6, exon 6, part of 3′-UTR	54
G3	516	R: GCGTGGCTTCACAGTAG	4827–5342		54