Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Nucleotide sequences of primers used for real time PCR detection
| Gene | Primer sequence (5’ to 3’) |
|---|---|
| Lrp5 |
Forward: ctgccaggatcgctctgatg |
| Reverse: acactgttgcttgatgaggacacac | |
| β-catenin |
Forward: gccacaggattacaagaagc |
| Reverse: ccaccagagtgaaaagaacg | |
| OPG |
Forward: ttacctggagatcgaattctgcttg |
| Reverse: gtgctttcgatgaagtctcagctg | |
| RANKL |
Forward: gcagcatcgctctgttcctgta |
| Reverse: cctgcaggagtcaggtagtgtgtc | |
| GAPDH | Forward: gaccacagtccatgccatcac |
| Reverse: gctgttgaagtcgcaggagac |
