Table 1.

Novel and Known Simple Nucleotide Variations (SNV) Identified in CHRNA5 of African-American Heavy Smokers.^d

Marker# (Figure 2)	SNV ID	SNV Locationa	Gene Region	SNV Polymorphism	Minor Allele Freqs. (Minor alleles/Total alleles)	Type of Change	Amino Acid Change	PolyPhen2
1	rs2036527	Chr15:78851615	distal promoter	G>A	0.243 (116/478)
2	rs3841324	Chr15:78857813–78857834	proximal promoter	GGGCGGGGCCAGAGGGAAATAG>-	0.25 (125/500)
3	rs503464	Chr15:78857896	5′UTR	T>A	0.251 (102/406)
4	rs55853698	Chr15:78857939	5′UTR	T>G	0.133 (54/406)
5	rs201545082	Chr15:78857943	5′UTR	C>G	0.0025 (1/406)
6	rs55781567	Chr15:78857986	5′UTR	C>G	0.222 (90/406)
7	Novel SNP	Chr15:78858154	exon 1	C>T	0.0025 (1/406)	synonymous	G31G	N/A
8	rs201277469	Chr15:78858281–78858282	intron 1	->T-ins	0.081 (40/492)
N/Ac	rs10709956	Chr15:78872835	intron 1	A>-	NDc
N/A	rs621849	Chr15:78872861	intron 1	A>G	ND
9	Novel Mutation	Chr15:78873006–78873007	intron 1	TC>-	0.002 (1/476)
10	rs569207	Chr15:78873119	intron 1	C>T	0.246 (117/476)
11	rs200692387	Chr15:78873147	intron 1	A>T	0.002 (1/476)	polypyrimidine tract
12	rs79835149	Chr15:78873220	exon2	C>T	0.050 (24/476)	synonymous	Y58Y	N/A
13	Novel Mutation	Chr15:78873257–78873261	exon 2	AAAAT>-	0.002 (1/484)b	frame-shift	N/A	N/A
14	Novel SNP	Chr15:78873311	intron 2	T>G	0.002 (1/484)	splice site
15	Novel Mutation	Chr15:78873319–78873325	intron 2	CCTTCTA>-	0.008 (4/484)
16	Novel SNP	Chr15:78878907	intron 2	A>G	0.002 (1/490)
17	rs148722844	Chr15:78879017	exon 3	G>A	0.002 (1/490)	non-synonymous	V97I	Probably damaging
18	rs144060843	Chr15:78879066	intron 3	G>T	0.008 (4/490)
19	rs12898919	Chr15:78880577	intron 3	G>C	0.004 (2/488)
20	rs201192025	Chr15:78880650	intron 3	T>C	0.002 (1/488)	polypyrimidine tract
21	rs2229961	Chr15:78880752	exon 4	G>A	0.004 (2/488)	non-synonymous	V134I	Probably damaging
22	rs114945237	Chr15:78880887	intron 4	G>A	0.006 (3/488)
23	Novel SNP	Chr15:78880907	intron 4	A>G	0.002 (1/488)
24	Novel SNP	Chr15:78880919	intron 4	G>T	0.004 (2/488)
25	Novel SNP	Chr15:78880925	intron 4	G>T	0.002 (1/488)
26	rs80087508	Chr15:78882233	exon 5	A>G	0.025 (10/398)	non-synonymous	K167R	Probably damaging
27	rs138719535	Chr15:78882529	exon 5	T>A	0.002 (1/482)	non-synonymous	F266I	Probably damaging
28	rs61740655	Chr15:78882726	exon 5	C>T	0.029 (14/488)	synonymous	T331T	N/A
29	rs79109919	Chr15:78882821	exon 5	T>A	0.05 (24/478)	non-synonymous	L363Q	Probably damaging
30	rs16969968	Chr15:78882925	exon 5	G>A	0.096 (46/478)	non-synonymous	D398N	Benign
31	Novel Mutation	Chr15:78885285	intron 5	C/-	0.008 (4/474)
32	rs67529014	Chr15:78885369	intron 5	G>C	0.004 (2/474)
33	rs199881121	Chr15:78885677	3′UTR	A>G	0.002 (1/474)

^aSNV locations are based upon human genome build NCBI/GRCh37.p5.

^bMay be personal SNV - mutant allele not seen in larger AA populations genotyped (0/974 cocaine addicted and 0/650 opiate addicted)

^cN/A=not applicable; ND = not determinable

^dDue to amplification failures and/or poor sequencing of some samples, total alleles analyzed varies from 398 to 500.