Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
The loci, primer sequences, annealing temperature and the product length of amplified gene
| Gene locus | Primer sequences (5′-3′) | Annealing temperature (°C) | Product length (bp) |
|---|---|---|---|
| rs2592551 |
GGACTTAGAAAGGAACGGATGA |
61.2 |
381 |
| CTTGAGAAAAGGCAAAGCAGAC |
