Table 2.
Primer sequences for round 2
| Primer name | Primer Sequence | Attach site | Product length |
|---|---|---|---|
| sense, inner/S2 | 5'TAGCCACTATAGGTGGGTCT3’ | 163–400 | 237 bp |
| anti-sense, outer/AS1 | 5'CCCACTGGTCCTTGTCAACT3’ |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.