Figure 7.

Determination of the processivity of archaeal DNA polymerases. (A–F) Gel electrophoresis analysis of primer strand extension seen using the polymerase variants and times indicated for: (A) Pfu-Pol wild type; (B) Pfu-Pol M247/L381; (C) Pfu-Pol L381R/K501R; (D) Pfu-TkodTS; (E) Pfu-TkodTS L381R/K501R; (F) Tkod-Pol wild type. The starting primer and fully extended product are both arrowed. The primer-template used was: 5′-GGGGATCCTCTAGAGTCGACCTGC 3′-CCCCTAGGAGATCTCAGCTGGACGACCGTTCGTTCGAACAGAGTACCTGGCTAT The primer was labeled at the 5′-teminus with fluorescein and the reaction initiated by the simultaneous addition of Mg²⁺ and the uracil rich single-stranded trapping oligodeoxynucleotide 5′-GTTGGUACUCTUAGUCTUTAGGT (extensions labeled + trap). For the extensions labeled—trap the competitor was omitted. Larger versions of each of the gel are given in the supplementary section (supplementary data Figure S7).