Table 2.
Representative common n-mer details over represented in the embolism with respective transcription factors and their probable roles.
| n-mers | Z-score | Regulation mode | Probable role | Consensus matches to n-mer in the PLACE 25.0.1 database |
|---|---|---|---|---|
| AAAT** | 3.5 | Positive | Dehydration responsive | Matched AAAT at offset 4 in CACTAAATTGTCAC 14BPATERD1: “14 bp region” (from −599 to −566) necessary for expression of erd1 (early responsive to dehydration) in dehydrated Arabidopsis |
| ATAA** | 4.0 | Positive | Sugar responsive | Matched ATAA at offset 2 in ACATAAAATAAAAAAAGGCA −314MOTIFZMSBE1: located between −314 and −295 region of maize (Z.m.) Sbe1 gene promoter; critical positive cis element; important for the high-level, sugar-responsive expression of the Sbe1 gene in maize endosperm cells; recognized by nuclear protein |
| ATAT** | 2.7 | Positive/negative | MADS domain | Matched [AT][AT][AT][AT] at offset 5 in TTDCCWWWWWWGGHAA AGAMOUSATCONSENSUS: binding consensus sequence of Arabidopsis (A.t.) AGAMOUS MADS domain |
| AATA | 3.3 | Positive | Sugar-responsive | Matched AATA at offset 6 in ACATAAAATAAAAAAAGGCA −314MOTIFZMSBE1: Located between −314 and −295 region of maize (Z.m.) Sbe1 gene promoter; critical positive cis element; important for the high-level, sugar-responsive expression of the Sbe1 gene in maize endosperm cells; recognized by nuclear protein |
| TTAT | 3.1 | Positive | Sugar responsive, binding activity to Myb core | Matched AATA at offset 6 in ACATAAAATAAAAAAAGGCA −314MOTIFZMSBE1: located between −314 and −295 region of maize (Z.m.) Sbe1 gene promoter; critical positive cis element; important for the high-level, sugar-responsive expression of the Sbe1 gene in maize endosperm cells; recognized by nuclear protein; matched TATT at offset 2 in TTTATTTACCAAACGGTAACATC23BPUASNSCYCB1: “23 bp UAS (Upstream activating sequence)” found in the promoter of Nicotiana sylvestris (N.s.) CycB1 gene; located between −386 and −409; contains a 5 bp element identical to the MYB binding core (ACGT); required for M-phase-specific expression; binds protein complexes in a cell cycle-regulated manner |
| ATCA** | 4.5 | Positive/negative | MADS domain, homeobox binding domain | Matched [AT][AT][ACGT][ACGT] at offset 8 in NTTDCCWWWWNNGGWAAN AGL1ATCONSENSUS: binding consensus sequence of Arabidopsis (A.t.) AGL1 (AGAMOUS-like 1); AGL1 contains MADS domain; see S000339; AGL20 is a MADS domain gene from Arabidopsis that is activated in shoot apical meristem during the transition to flowering; AGL20 is also regulated by the Gibberellin pathway; complex regulatory net works involving several MADS-genes underlie development of vegetative structures |
| GAAG** | 4.0 | Positive | ABA-responsive, MADS | Matched GAAG at offset 6 in ATGTACGAAGC ABAREG2: motif related to ABA regulation; gene: sunflower helianthinin; transacting factor: bZIP? Matched [ACGT][ACGT][AT][ACGT] at offset 0 in NNWNCCAWWWWTRGWWAN AGL2ATCONSENSUS: binding consensus sequence of Arabidopsis (A.t.) AGL2 (AGAMOUS-like 2); AGL2 contains MADS domain; AGL2 binds DNA as a dimer |
| CGAA | 2.4 | Positive | ABA-responsive | Matched CGAA at offset 5 in ATGTACGAAGC ABAREG2: motif related to ABA regulation; gene: sunflower helianthinin; transacting factor: bZIP? |
An html table for all n-mers is presented in Supplementary Table 1.
**
denotes overrepresentation.