Table 1.
Primer pairs (F: forward; R: reverse of the eight reference and eight genes of interest) used in the qPCR analysis of the relative abundance of reference genes (Ref) and genes of interest (GOI) in the taproot tissue of alfalfa cultivars exposed to a water deficit.
| Ref or GOI | Gene name | GenBank accession number/reference | Function/annotation | Primer sequence | Predicted fragment size (bp) | Tm (°C) | Region of fragment |
|---|---|---|---|---|---|---|---|
| Ref | ADP-ribosylation factor | AY466444 | Punitive ADP-ribosylation factor | F: TTTCCTGAGTCTGGTGGTTC | 109 | F: 57.68 | UTR: 100 % |
| R: ACCCCAAGTAACACTGACGA | R: 58.06 | Coding: 0 % | |||||
| Ref | Phosphoprotein phosphatase type 2A | X70399/Pirck et al. (1993) | Phosphoprotein phosphatase | F: TGCTGGATGTCATACTGAGG | 98 | F: 57.17 | UTR: 100 % |
| R: CTCCAGAAAGGGTGTCCAG | R: 58.20 | Coding: 0 % | |||||
| Ref | Histone H3 | X13674/Wu et al. (1989) | Encodes for histone H3 protein | F: CATTCATGCTAAGCGTGTCA | 100 | F: 58.45 | UTR: 25 % |
| R: CCCTAACAAAGCGAATCAAC | R: 57.37 | Coding: 75 % | |||||
| Ref | GTP-binding protein | X79278/Jonak et al. (1995) | Protein product homologous to small GTP-binding proteins | F: TCCGAAAGTGAGAGAGATACAAA | 119 | F: 58.14 | UTR: 100 % |
| R: CCAGCAGCTCCTATTGAAAC | R: 57.58 | Coding: 0 % | |||||
| Ref | Translationally controlled tumour protein | X63872/Pay et al. (1992) | Protein product homologous to a translationally controlled human tumour protein | F: ACTACAAGGATGGTGCTGCT | 110 | F: 57.41 | UTR: 36 % |
| R: TGATAAATTAGGGGCAGAACA | R: 57.27 | Coding: 64 % | |||||
| Ref | Calmodulin | X52398/Barnett and Long (1990) | Calcium-binding protein | F: ACAGGGCAAATGAGTTTTGA | 99 | F: 58.20 | UTR: 100 % |
| R: AACAAACCGACCAACAAAAA | R: 58.03 | Coding: 0 % | |||||
| Ref | Elongation initiation factor | X59441/Pay et al. (1991) | Homologue of eukaryotic translation initiation factor 4D | F: TCATTTCTCTAAGCTTTCACATTG | 86 | F: 57.79 | UTR: 100 % |
| R: CATAAACACCACCAACACCA | R: 57.71 | Coding: 0 % | |||||
| Ref | Glyceraldehyde-3-phosphate dehydrogenase | GQ398120 | Phosphate dehydrogenase | F: TGGAATCGTTGAGGGTCTTA | 100 | F: 58.15 | UTR: 0 % |
| R: AGCTCTTCCACCTCTCCAGT | R: 58.06 | Coding: 100 % | |||||
| GOI | Cold acclimation response protein (CAR1/cas15) | AF072932/Haagenson et al. (2003) | Punitive nuclear regulatory protein | F: GCTTCATCATGTTGAGAGGTG | 98 | F: 58.30 | UTR: 100 % |
| R: TTTCTTTCCACACACACACG | R: 58.14 | Coding: 0 % | |||||
| GOI | Bi-modular protein (corC) | L22305/Castonguay et al. (1994) | Regulation of plant development | F: GCACGATTGACTTTCACGA | 87 | F: 58.34 | UTR: 100 % |
| R: ACAGCGATACACCGTGATTT | R: 58.10 | Coding: 0 % | |||||
| GOI | Cold- and drought-regulated protein (corA) | L03708/Laberge et al. (1993) | Cold- and drought-induced protein of unknown function | F: CACCATGCACTCTTTCTCAGT | 100 | F: 57.94 | UTR: 100 % |
| R: AACTGAAACTGCTGCACATCT | R: 57.62 | Coding: 0 % | |||||
| GOI | Cold acclimation-specific protein (cas18) | L07516/Wolfraim et al. (1993) | Cold-induced punitive dehydrin protein | F: TCTGTTTTTGAGTAAGTTGGTTCA | 123 | F: 58.04 | UTR: 100 % |
| R: TGCCCCTACACTAAAATTCAA | R: 57.33 | Coding: 0 % | |||||
| GOI | Protein kinase | X82270/Jonak et al. (1996) | Stress signalling protein | F: CACTGCTGGGAATTCAATCT | 99 | F: 57.74 | UTR: 100 % |
| R: CAACAGAAAGCAGGGTAAGC | R: 57.63 | Coding: 0 % | |||||
| GOI | Galactinol synthase (corF) | AY126615/Cunningham et al. (2003) | Synthesis of raffinose family oligosaccharides (RFOs) | F: CAGCAATTTTGGAAGCTTATG | 95 | F: 57.62 | UTR: 42 % |
| R: AGACGATCATGCGGCTAATA | R: 58.36 | Coding: 58 % | |||||
| GOI | Type 1 sucrose synthase mRNA | AF049487 | Synthesis of sucrose | F: ATGCTCTCAAGTACCGCAAA | 96 | F: 58.53 | UTR: 46 % |
| R: CGGTTTCTCCATTTCTTCATT | R: 58.17 | Coding: 54 % | |||||
| GOI | High-molecular-weight vegetative storage protein | AF530579/Volenec et al. (2002) | Vegetative storage protein | F: ACTTTGATTCCCTCCGTTTT | 106 | F: 57.64 | UTR: 100 % |
| R: AGCGCGCAATTCAATTTTA | R: 59.44 | Coding: 0 % |