Table 1. Primers used in this study.

Primer	Sequence (5′→3′)	Purpose of amplification
dl9-F	cccggatccggtaattgtttgagatcccac	5′ UTR of senX3
dl10-R	cccggatcccagcgccgagaacacagtcac
IR-F	cccggatccagagctgagccgatgacct	IR and co-expression
IR-R	cccggatccctcgtcctccacaatcaaca
senX3-F	ccgagttgatcgagctatcc	senX3 gene expression
senX3-R	agtgcggtaaccagcagagt
regX3-F	tgttgattgtggaggacgag	regX3 gene expression
regX3-R	cgcaactgcttgcatacatc
sigA-F	ctacgctacgtggtggattc	sigA gene expression
sigA-R	ggtgatgtccatgtctttgg
dl18-R	ccttgtcgatctcgctatcc	Biotinylated single strand regX3 probe
SR-F	ccaaactctgctggttaccg	senX3-regX3 co-transcript
SR-R	agcatcagatcgagcaggac