Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2014 Apr 20;42(10):6352–6364. doi: 10.1093/nar/gku295

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited

PMC Copyright notice

Figure 3. — RAG2^FS/FS;p53^−/− mice develop rapid lymphoma with genomic instability. (A) Kaplan–Meier survival curve of the indicated genotyped. P versus p53^−/− mice. (B) SKY analysis of RAG2^FS/FS;p53^−/− T cell lymphomas. * indicates antigen receptor chromosome. (C) Genomic lesions from RAG2^FS/FS;p53^−/− tumor 13422. The lesions are divided into two groups: General and potential V(D)J mediated. Bold capital letters represent the junction sequence; small letters represent the reference genome at the break points, bold italic letters are microhomologies, red small letters are the cRSSs with bold red representing matches to consensus RSS. Configuration of lesions are indicated to the right; Del, deletion; Inv, inversion; Tx, translocation. ^§140 bp homology at the junction. *cagcaccacaaacaggacctagtcccgcactgcttggcgataactgcctagctacagggctaggtgctctttggatgcacatgcgcttcactgcacaaaatca.