TABLE 1.

PCR primers used to produce CRP-GM-CSF fusion gene and to introduce NotI restriction sites into the CRP flanking DNA constructs^a

Primer	Sequence (5′-3′)	Purpose
Fu5PR	AAT AAT TTT GCG GCC GCT CTT CCC GAA GCT CTG ACA CC	5′-Terminal primer for the production of fusion between CRP and GM-CSF; the NotI site introduced at the 5′ end is in boldface
Fu3PR	GGA TTA CGA GCG GCC GCA TCC TAT TAT TTT TGG ACT GG	3′-Terminal primer for the production of fusion between CRP and GM-CSF; the NotI site introduced at the 3′ end is in boldface
TM8	GCT TTT GGC CAG ACA ACGCGTAGCCCGATCACTGTC	Internal fusion primer for amplification of the GM-CSF half of the CRP/GM-CSF fusion; the underlined region is complementary to GM-CSF
TM7-2	GAC AGT GAT CGG GCT ACG CGT TGTCTGGCCAAAAGC	Internal fusion primer for amplification of the CRP half of the CRP/GM-CSF fusion; the underlined region is complementary to CRP
CRP R1	CTG AGG CCA GCG GCC GCT CCT GAA GGT ACC TCC CGG TT	Used in inverse PCR for the production of vectors carrying CRP flanking DNA; introduces a NotI restriction site (in boldface) at the 3′ end of the CRP gene
CRP L1	TCG GGA AGA GCG GCC GCA AAA TTA TTT CAG ACC AGA GA	Used in inverse PCR for the production of vectors carrying CRP flanking DNA; introduces a NotI restriction site (in boldface) at the 5′ end of the CRP gene

^aThe sequences of oligonucleotides used in PCRs for the construction of CRP/GM-CSF, pGM-BNB, and pGM-C79 are presented.