Table 1.
Oligonucleotides used in this study.
| Name | Sequence (5′–3′) | Description |
|---|---|---|
| ΔN70pro Off Fw | 5′ CGCACATATGGAGGCAAAGCAGGACAGAGTC 3′ | Used for PCR amplification of ΔN70pro and cloning in pGBKT7 vector. NdeI restriction site underlined |
| ΔN70pro Rev | 5′ CGGGATCCTTACTCATTAGACCTTAAGAGG 3′ | Used for PCR amplification of ΔN70pro and cloning in pGBKT7 vector. The BamHI site underlined |
| VPg off Fw | 5′ CCCAGCTAGCCATATGACTCTCCCACCGGAGC 3′ | Used for PCR amplification of VPg and cloning in pGBKT7 vector. NheI and NdeI sites are shown bold and underlined respectively |
| VPg Rev | 5′ CGGGATCCTCACTCTTGAGCGTTTTCCC 3′ | Used for PCR amplification of VPg and cloning in pGBKT7 vector. The HamHI site underlined |
| p10 Fw1 | 5′ GCCCGAATTCCACCGTCGCTGTTGAGAAT 3′ | Used for PCR amplification of p10 and cloning in pRSF duet vector. EcoRI is shown in bolt |
| p10 Fw2 | CTAGCTAGCCATATGACCGTCGCTGTTGAG | Used for PCR amplification of p10 and cloning into pGBK vector. NdeI site is shown in bolt |
| p10 Rev1 | 5′ CCCGTCGACTTATTCCTGCTTGTAATAACAAGG 3′ | Used for PCR amplification of p10 and cloning in pRSF duet vector. SalI site is underlined |
| p10 Rev2 | 5′ CGGGATCCTCATTCCTGCTTGTAATAACAAGG 3′ | Used for PCR amplification of p10 and cloning in pGBKT7 vector. BamHI site is underlined |
| p8 Fw | 5′ CTAGCTAGCCATATGAGTTTAATCCTTCCAGAGTCC 3′ | Used for PCR amplification of p8 cloning in pGBKT7 vector. The NdeI restriction site is underlined |
| p8 Rev | 5′ CGGGATCCTCAGTAACACAGAGAGCAACAAG 3′ | Used for PCR amplification of p8 and cloning in pGBKT7 vector. The BamHI site underlined |
| RdRp Tsen Off | 5′ GCGTGCTAGCCATATGACCGTCGCTGTTGAGAATTTTAAACTGCCAGC 3′ | Used for PCR amplification of RdRp and cloning in pGADT7 and pRSF duet vectors. NheI and NdeI sites are shown in bold letters and underlined respectively |
| RdRp Rev | 5′ CGCCTCGAGCGAATCCGCACCATAGCACCCTG AGCA 3′ | Used for PCR amplification of full length RdRp and cloning in pGADT7 and pRSF duet vectors. XhoI restriction site was underlined |
| RdRp CΔ43 Rev | 5′ TTACTCGAGGTCTCCAGAGTGTTCGC 3′ | Used for PCR amplification of RdRp C-terminal 43 amino acids deletion mutant and cloning in pGADT7 and pRSF duet vector. XhoI restriction site underlined |
| RdRp CΔ 85 Rev | 5′ GGGTTACTCGAGAGGCCAGTGGGGCGAA G TTTC 3′ | Used for PCR amplification of RdRp C-terminal 85 amino acids deletion mutant and cloning in pGADT7 and pRSF duet vector. XhoI restriction site underlined |
| CP off Fw | 5′ GCCCCATATGGCGAAAAGGCTTTCGAAACAACAG 3′ | Used for PCR amplification of CP. NdeI restriction site underlined |
| CP ORF Rev | 5′ TCA CCC GGG GTT GTT CAG GGC TGA GGC AG 3′ | Used for PCR amplification of CP. SmaI restriction site underlined |