TABLE 2.
Oligonucleotide primers used in this study
| Oligonucleotide | Sequence (5′–3′) | Purpose | Reference |
|---|---|---|---|
| JRP3803 | GCGCGCAAGCTTTGCGAAGAAGCCTTTGAATAC | Amplification of PattCI for cloning into pJIR750 | This study |
| JRP3804 | GCGCGCGCATGCAGTCCTTGACATTTTTCTTAT | Amplification of PattCI for cloning into pJIR750 | This study |
| JRP3820 | GCGCGGATCCCCTTAAACTATGAGGATGTT | Amplification of tcpG and the upstream region; includes the BamHI site | 19 |
| JRP3821 | GCGCGGTACCTTATTCTACGACTCTTCTTACA | Amplification of tcpG and the upstream region; includes the KpnI site | 19 |
| JRP4321 | GCGGTACCTTCCTTTTGAAGCACATCCACTG | Amplification of feoB and the upstream region; includes the KpnI site | This study |
| JRP4322 | CGGGATCCGAATAATTTAATTAGGGGGAAAACTAATGAC | amplification of feoB and the upstream region; includes the BamHI site | This study |
| JRP4313 | TTGATGCAGGACGATTTGATTG | Forward oligonucleotide for tcpG qRT-PCR analysis | This study |
| JRP4314 | TTTCTCTTGGCCCTAACTGTATTCC | Reverse oligonucleotide for tcpG qRT-PCR analysis | This study |
| JRP2479 | CCATCTGTTTTTATATCTGCTCCAGTA | rpoA, forward oligonucleotide for qRT-PCR analysis | 32 |
| JRP2480 | GGAAGGTGAAGGACCAAAAACTATT | rpoA, reverse oligonucleotide for qRT-PCR analysis | 32 |
| JRP5715 | GTCGGAGAATACAAAATCTC | Amplification of attL from Tn4451 for SOE-PCR | This study |
| JRP5716 | CTTCTTGAACACTTGCCGACCTTTCCGTATGTATTTTTTC | Amplification of attL and SOE-PCR to splice together the attL site with the 5′ end of catP | This study |
| JRP5717 | GAAAAAATACATACGGAAAGGTCGGCAAGTGTTCAAGAAG | SOE-PCR to splice together the attL site with the 5′ end of catP | This study |
| JRP4071 | GTCCGTAAAGAAATCGCCCATTAGTTACAGACAAACCTGAAG | SOE-PCR to splice together the attR site with the 3′ end of catP | This study |
| JRP4072 | CTTCAGGTTTGTCTGTAACTAATGGGCGATTTCTTTACGGAC | SOE-PCR to splice together the attR site with the 3′ end of catP | This study |
| JRP5720 | CACCTATTTTAAAGGTTCC | Amplification of attR from Tn4451 for SOE-PCR | This study |
| JRP2142 | CTCAGTACTGAGAGGGAACTTAGATGGTAT | catP probe for Southern blotting | 33 |
| JRP2143 | CCGGGATCCTTAGGGTAACAAAAAACACC | catP probe for Southern blotting | 33 |
| JRP2980 | AATAAGTAAACAGGTAACGTCT | ermB probe for Southern blotting | 34 |
| JRP2981 | GCTCCTTGGAAGCTGTCAGTAG | ermB probe for Southern blotting | 34 |
| JRP3947 | GGGAACGAAACGAAAGCG | TargeTron probe for Southern blotting | 26 |
| JRP3948 | CGTAATAAATATCTGGAC | TargeTron probe for Southern blotting | 26 |