Table 1.
List of primers used to amplify the internal transcribed spacer (ITS) region rRNA and estimated location of primer sites
| Primers | Sequence 5′–3′ | Temp. (°C) | References |
|---|---|---|---|
| 18S-ITS uni-for | gtgaacctgcggaaggatcatt | 56.0 | Ruprecht et al. (2012) |
| nr-SSU-1780-5′-mod | tgcggaaggatcattgattc | 55.3 | Piercey-Normore and Depriest (2001, modified) |
| ITS1T | ggaaggatcattgaatctatcgt | 55.0 | Kroken and Taylor (2000) |
| ITS1aT | atctatcgtgxmmacaccg | 54.4 | This study |
| ITS1-sense-A | tccacaccgagmacaac | 54.0 | This study |
| ITS2-antisense-A | aaggtttccctgcttgaca | 54.5 | This study |
| ITS4 | tcctccgcttattgatatgc | 55.3 | White et al. (1990) |
| ITS4bT | ccaaaggcgtcctgca | 54.3 | This study |
| ITS4aT | atctatcgtgxmmacaccg | 54.5 | This study |
| ITS4T | gttcgctcgccgctacta | 56.0 | Kroken and Taylor (2000) |
| |||