Table 3.

Primers and Probes Used for Quantitative Reverse Transcription Polymerase Chain Reaction

Name	Gene/location	Sequence
Primer a (WL102)	Dystrophin exon 26 (forward primer)	5′ gattttgaatataaaactccagatgaa
Primer b (WL103)	Dystrophin exon 27 (reverse primer)	5′ ggagtttcactttcgcttcttt
Primer c (WL104)	Dystrophin exon 48 (forward primer)	5′ aaccaaccaaaccaagaagg
Primer d (WL105)	Dystrophin exon 49 (reverse primer)	5′ gctgccctttagacaaaatctc
Rplp0 forward primer	Ribosomal protein large P0	5′ ctccaagcagatgcagcaga
Rplp0 reverse primer	Ribosomal protein large P0	5′ atagccttgcgcatcatggt
Probe WL145	The junction of the dystrophin head and body vectors	5′ agagatgaagagagctaaagaagaggccc
Probe WL146	The junction of the dystrophin body and tail vectors	5′ tttgacgttcaggaaactgaaatagcag
Probe WL147	The junction of the dystrophin head and tail vectors	5′ agagatgaaggaaactgaaatagcagtt
Rplp0 Probe	Ribosomal protein large P0	5′ ccgtggtgctgatgggcaagaa