Skip to main content
. 2014 Jun 20;9(6):e99439. doi: 10.1371/journal.pone.0099439

Figure 4. A putative 1208-DUX4 fusion transcript which would have been amplified using the the forward CIC-4105F and reverse DUX4-1538R primers.

Figure 4

All the primers used in the study are denoting the primers sequences (in box) together with orientation (arrows). The search sequences “GCCGCCTTCCAGGCCCGCTA” (“grep” 1) and “CAGGGGGCCCTGACCCCACC” (“grep” 2) used as search terms in the “grep” command-line utility are colored yellow and in box. The fusion point between CIC and DUX4 is in red. The part of the protein coded by this CIC-DUX4 fusion transcript fragment is shown under the nucleotide sequence. The nucleotide sequence has been deposited in the GenBank with accession number KJ670706.