TABLE 1.

Oligonucleotide primers used in this study

Primer designation	Configuration	Sequence (5′→3′)a
A*	BamHI	actagtggatcccccggg
B*	SnabI	caaaaggtgatacgtacactt
M1	−13/−11 ATA→TAC	ccctttttctaTACtgcaccta
M2	−13/−10 ATAT→GGGG	ctttttctaGGGGgcaccta
M3	−16 C→A	tccctttttAtaatatgcacct
M4	−16 C→G	ttccctttttGtaatatgcacc
M5	−16 C→T	tttccctttttTtaatatgcacc
M6	−16/−14 CTA→GAC	tttccctttttGACatatgcacc
M7	−40/−37 TTGA→CCCC	ttactatttCCCCagctgtgt
M8	−36/−35 AG→CA	ttactatttttgaCActgtgt
M9	Deletion of −25 and −24 bases	gaagctgtgtatt..cctttttc
M10	Insertion between −25 and −24 bases	gaagctgtgtatttTCccctttttc
M11	−52, −51, −49, −48 T→G	gtaggttcaaGGaGGactatt

^aSequences complementary to the target DNA are lowercased; sequences unique to the oligonucleotide primers are shown in capital and bold letters; deleted nucleotides are indicated by dots; restriction sites used for cloning are in bold letters and underlined. The sequence of A* and B* primers contains the restriction sites used in the cloning.