Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Oligonucleotide probes
| Probe | Sequence (5′ to 3′) | FAa (%) | Specificity | Reference |
|---|---|---|---|---|
| EUB338 | GCTGCCTCCCGTAGGAGT | 20 | Most Bacteria | (1) |
| MB | AGCGCCGTCGGGTAAGA | 30 | Genus Methylobacterium | (40) |
| Comp MBb | AGCGCCGTCTGGTAAGA | — | Competitor for MB | this study |
| Help MBc | CCAACTCCCATGGTGTGACGG | — | Helper for MB | this study |
FA, formamide concentration in the hybridization buffer.
Unlabeled probe MB used as a competitor to enhance specificity.
Unlabeled probe MB used as a helper to enhance specificity.
