Skip to main content
. 2014 Jun 20;6(6):2428–2443. doi: 10.3390/v6062428

Table 1.

Primers used for generating pBAC-C-KCE, donor plasmid pRThGA and identification of the pBAC-C-KCE-E.

Purpose and Primer Sequence (5’→3’) Sequence Designation, Restriction Enzyme Site and Introduction Sequence
E Gene Clone a
E-1F aaaggatccatgttcagctgtctggggatgcag BamH I site (bold)
E-1R aaggaattcggcattgacatttactgccaggaa EcoR I site (bold)
BAC Insertion b
US2-F aaagtcgacataacttcgtatagcatacattatacgaagttatcacgtcttcccgcgaggcc Sal I site (bold), Lox p sequence (underline)
US2-R ttaattaacgcggacaaaacgacgattac Pac I site (bold)
SORF3-F gtaatcgtcgttttgtccgcgttaattaatgaaaaagacggcggtacaat Pac I site (bold)
SORF3-R aagaatgcattcggcctgg
Red-F accagccagctgcgcttgctcgtggggtgtggtgcttttggt
Red-R tcgagcggccgctagggataacagggtaatccccaccttatatattctttcccaccctcgaagagcgttc Not I site (bold), I-isce I sequence (underline)
Amp-F aaattaattaaggggataacgcaggaaagaac Pac I site (bold)
Amp-R aaattaattaaacgtcaggtggcacttttcg Pac I site (bold)
Modification pRThGA c
pCA-I-SceI-H1-F aaatagggataacagggtaatgttgagcctttttgtggagtgggttaaattgtactagcgcgtttcgctttgcagtacatctacgtattagtcatcgctatta I-isce I sequence (bold), Homology arm H1 (underline)
pCA-I-SceI-H2-R aaatagggataacagggtaattagcatgcataacttcgtataatgtatgctatacgaagttatgcggccgc
cacacaggaaacagctatgaccatgattac
I-isce I sequence (bold), Homology arm H2 (underline)
Amp t-I-SceI-F aaaattaccctgttatccctacacgttaagggattttggtcat I-isce I sequence (bold)
OriT-R6K-I-SceI-R aaaattaccctgttatcccta I-isce I sequence (bold)
Identification E d
E-2F atgttcagctgtctggggatgcag
E-2R ggcattgacatttactgccaggaa

a. Primers used to the clone the E gene of DTMUV; b. Primers used for the construction of the BAC insertion vector; c. Primers used for verification of the E gene inserted into the pBAC-C-KCE base using the MAGIC strategy; d. Primers used for the identification of the E gene of DTMUV.