Table 1. The DNA duplexes used to investigate M.EcoKI.
| Duplex number | DNA duplexa | Fluorescence emission maxima (nm) and intensity increase | ||
|---|---|---|---|---|
| DNA alone | DNA + M.EcoKI | DNA + M.EcoKI + AdoMet | ||
| 1 | 5′(N)nA(AmP)C(N)6GTGC(N)n3′ | 380 | 370 (10-fold) | 430 |
| 3′(N)nT T G(N)6CACG(N)n5′ | ||||
| 2 | 5′(N)nAAC(N)6G T GC(N)n3′ | 380 | 370 (10-fold) | 370b |
| 3′(N)nTTG(N)6C(AmP)CG(N)n5′ | ||||
| 3 | 5′(N)nA(AmP)C(N)6G T GC(N)n3′ | 380 | 365 | 365b |
| 3′(N)nT T G(N)6C(AmP)CG(N)n5′ | ||||
| 4 | 5′(N)nA(AmP)C(N)6G T GC(N)n3′ | 380 | 370 (11-fold) | 430 |
| 3′(N)nT T G(N)6C(MeA)CG(N)n5′ | ||||
| 5 | 5′(N)n(AmP)AC(N)6GTGC(N)n3′ | 380 | 370 (12-fold) | 365 |
| 3′(N)nT TG(N)6CACG(N)n5′ | ||||
aAll oligodeoxynucleotides are based on the ‘parent’ duplex (M.EcoKI recognition site in bold, bases that are the target for CH3 group addition underlined): 5′ CACGGGCCTAACGATATCGTGCGTACGAGC 3′; 3′ GTGCCCGGATTGCTATAGCACGCATGCTCG 5′. Only the bases that comprise the M.EcoKI recognition sequence are shown in full in the table, other bases being designated by the letter N. AmP is 2-AP, MeA is 6-methyl-adenine. Underlined bases are at the position of methyl group addition. The parent duplex was used in either the fully un-methylated form or a hemi-methylated form with the lower oligodeoxynucleotide methylated.
bThe 2-AP* spectrum was a weak shoulder on the side of the normal 2-AP spectrum for these duplexes.