Table 1. 16S Ribosomal RNA probes used for quantitative real-time polymerase chain reaction to quantify changes in components of the fecal microbiota during and after treatment with clindamycin.
Bacterial Target Familya | Bacterial Target Genus & Speciesa | Primer Name | Sequence (5′ → 3′) | Standard | Reference |
Bacteroidaceae, Prevotellaceae | Bacteroides spp. | Uni331F | TCCTACGGGAGGCAGCAGT | Bacteroides fragilis | [17] |
Bac708R | CAATCGGAGTTCTTCGTG | [18] | |||
Enterobacteriaceae | Enterobacter spp. | Eco1457F | CATTGACGTTACCCGCAGAAGAAGC | Escherichia coli | [19] |
Eco1652R | CTCTACGAGACTCAAGCTTGC | [19] | |||
Ruminococcaceae | Ruminococcus, Faecalibacterium, Ethanoligenes spp. and Clostridiales leptum subgroup | sg-Clept-F | GCACAAGCAGTGGAGT | Clotridium leptum | [20] |
sg-Clept-R | CTTCCTCCGTTTTGTCAA | [20] | |||
Lachnospiraceae | Blautia, Pseudobutyrivibrio, Roseburia spp. and Clostridiales coccoides group | Erec482R | GCTTCTTAGTCARGTACCG | Ruminoccus torques | probeBasepB-00963 [22] |
Eub338F | ACTCCTACGGGAGGCAGC | probeBasepB-00159 [22] | |||
Desulfovibrio-naeceae | Desulfovibro spp. | g-desulf-F | GGTACCTTCAAAGGAAGCAC | Desulfovibrio desulfuricans | [16] |
g-desulf-R | GGGATTTCACCCCTGACTTA | [16] | |||
Enterococcaceae | Enterococcus spp. | g-enter-F | CCCTTATTGTTAGTTGCCATCATT | Enterococcus faecium | [16] |
g-enter-R | ACTCGTTGTACTTCCCATTGT | [16] | |||
Veillonellaceae | Veillonella spp. | g-veill-F | A(C/T)CAACCTGCCCTTCAGA | Veillonella parvula | [16] |
g-veill-R | CGTCCCGATTAACAGAGCTT | [16] | |||
Prevotellaceae | Prevotella spp. | CFB286F | GTAGGGGTTCTGAGAGGA | Prevotella oris | probeBase pB-00045 [22] |
CFB719R | AGCTGCCTTCGCAATCGG | probeBase pB-00047 [22] | |||
Lactobacillaceae, Planococcaceae | Lactobacillus spp. | Uni331F | TCCTACGGGAGGCAGCAGT | Lactobacillus acidophilus | [17] |
Lacto371R | TGGAAGATTCCCTACTGC | probeBase pB-00195 [22] | |||
Bifidobacteriaceae | Bifidobacterium spp. | Bif551F | CGCGTCYGGTGTGAAAG | Bifidobacterium spp | [21] |
Bif794R | CCCCACATCCAGCATCCA | [21] | |||
Eubacteria | Total bacteria | 515F | GTGCCAGCAGCCGCGGTAA | B. fragilis &E. coli | [50] |
685R | TCTACGCATTTCACCGCTAC |
as determined using TestProbe from SILVA-ARB (www.silva-arb.de) [23].