Skip to main content
. Author manuscript; available in PMC: 2014 Jul 7.
Published in final edited form as: Biol Psychiatry. 2009 May 7;66(3):214–222. doi: 10.1016/j.biopsych.2009.02.033

Table 1. 5-HT1A DRE primers for competition assay.

The human 5-HT1A 5′ and 3′ DRE nucleotide sequences and location (relative to translation initiation site) of forward primers used for competition assays are aligned. The minimal consensus sequence in common among primers that competed for Freud-2 binding is underlined.

Sequence Name (Location) DNA sequence
5′-DRE (−1624/−1598) AGATGGCACTCTAAAACATTTGCCAGA
17-bp 5′ (−1624/−1608) AGATGGCACTCTAAAAC
16-bp 5′ (−1613/−1598)  TAAAACATTTGCCAGA
3′-DRE (−1597/−1565) AGGTGGCGACATAAAACCTCATTGCTTAGAACT
19-bp 3′ (−1597/−1578) AGGTGGCGACATAAAACCT
12-bp 3′ (−1578/−1566)   CATTGCTTAGAA