Figure 1. MSI1 is inhibited by monounsaturated fatty acids.
(A) Pattern of MSI1 (blue) in the CNS. (B–D) EMSA and FP of MSI1 binding to RNA aptamer CCCR005 (AGCGUUAGUUAUUUAGUUCG). EMSA data (red line) were fit to the Hill equation where all shifted species were fit as an aggregate. FP data (black line) were fit to a two-site binding model. (E and F) Assay scheme for the inhibitor screen (E) and F–EMSA dose responses with hits identified from the small molecule screens (E) and oleic and elaidic acid (F). Each gel is one representative experiment of at least three independent experiments. No compound and no protein lanes identify the position of bound and free RNA migration, respectively.
Figure 1—figure supplement 1.
(A) Coomassie-stained SDS page gel shows that recombinant MSI1 is purified to greater than 95% over a 3-column purification protocol. (B) MSI1 displays decreased affinity for an RNA aptamer upon addition of oleic acid. Apparent dissociation constants were determined by plotting fluorescence polarization as a function of MSI1 protein concentration and fitting the data to the Hill equation. 0 µM oleic acid: Kd, app = 16.3 ± 1.2 nM; 1 µM oleic acid: Kd, app = 18.1 ± 2.6 nM; 10 µM oleic acid: Kd, app = 40.5 ± 3.5 nM; 0 µM oleic acid: Kd, app > 2000 nM. (C) CMC determination by N-phenyl-1-naphthylamine (NPN) fluorescence in equilibration buffer (pH 8.0). Segmented linear regression was used to determine the breakpoint between baseline and micelle-associated NPN fluorescence. The value of the CMC presented is the average and standard deviation from three experiments.
Figure 1—figure supplement 2. RNA binding specificity and inhibition by specific fatty acids is conserved in MSI2.
(A) Sequence alignment shows 83% conservation between MSI1 and MSI2 within the RRM domains. Regions that correspond to α-helices, β-sheets, and intervening loops as defined by NMR spectroscopy are diagramed above the alignment. (B) MSI2 binds the MSI1 RNA aptamer CCCR005 with similar affinity to that of MSI1 by both FP and F–EMSA. The no protein control lane defines the position of free RNA. Data are the average and standard deviation of three independent experiments. (C) MSI2 is specifically inhibited by oleic acid and eicosenoic acid in FP and F–EMSA dose response experiments. No compound and no protein controls define the position of bound and free RNA respectively. Data are the average and standard deviation of three independent experiments.