Table 1.

Primers used for detection of H. pylori before and after treatment targeting specific genes.

S. number	Targeted gene		Primer sequence (5′-3′)	Product size	PCR condition, (annealing temperature and cycles) MgCl2 conc.
1	Heat shock protein (hsp60)14, conserved	Primary	AAGGCATGCAAGATAGAGGCT  CTTTTTTCTCTTTCATTTCCACTT	590 bp	94°C, 30 seconds, 56°C, 30 seconds;  72°C, 30 s (35 cycles) (60 mol/lit)
		Nested	TTGATAGAGGCTACCTCTCC  TGTCATAATCGCTTGTCGTGC	501 bp	94°C, 30 seconds, 56°C, 30 seconds;  72°C, 30 s (35 cycles) (60 mol/lit)
2	Phosphoglucosamine mutase (ureC/glmM), conserved	Primary	TTGGGGGTATAATTCAAGGG  TTAGTGAGCGCTCTAACTTCC	945 bp	94°C, 1 min, 59°C, 1 min;  72°C, 1 min (35 cycles) (60 mol/lit)
		Nested	GCAACAGAGCTTACCTGCTTG  GATTCAAATAGGGCCTATGC	882 bp	94°C, 1 min, 59°C, 1 min;  72°C, 1 min (35 cycles) (60 mol/lit)
3	Flagellum-specific ATP synthase (fliI)∗, conserved	Primary	CCCGATGCGAATGAGCATTTC  GCTTAACCCTTTAGGGCAAGTC	858 bp	94°C, 1 min, 56°C, 1 min;  72°C, 1 min (35 cycles) (60 mol/lit)
		Nested	GATGTCTTTAGCCACCCTTGATGT  GAGCATTGATGGGCTTTTGACTTGC	640 bp	94°C, 1 min, 56°C, 1 min;  72°C, 1 min (35 cycles) (60 mol/lit)

*In-house designed primers for this study; PCR-polymerase chain reaction.