Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of the primers and PCR products size
| Gene | Ref. sequence | Sequence | Product size |
|---|---|---|---|
| αv |
NM_002210 |
Forward: actggcttaagagagggctgtg |
110 |
| Reverse: tgccttacaaaaatcgctga | |||
| β3 |
NM_000212 |
Forward: agacactcccacttggcatc |
123 |
| Reverse: tcctcaggaaaggtccaatg | |||
| β5 |
NM_002213 |
Forward: agcctatctccacgcacact |
91 |
| Reverse: cctcggagaaggaaacatca | |||
| GAPDH | NM_001289746.1 | Forward: caactgtgaggaggggagatt |
97 |
| Reverse: cagcaagagcacaagaggaag |
