Table 2. Primers and PCR conditions used for amplification of seven overlapping fragments (5′NCR-prM, E, E-NS3, NS3, NS3-NS5, NS4B-NS5, and NS5-3′NCR) to obtain complete genomic sequence.
| PCR | Primer | Primer sequence (5′ 3′) | TBEV region (nt) | PCR conditions |
| 5′NCR-prM | OF | AGATTTTCTTGCACGTGC | 1–18 (+ sense) | 35 cycles of 94°C, 15 s; 54°C, 15 s; and 70°C, 25 |
| OR | CCACCCAGTTCCAGCACCAA | 1058–1039 (- sense) | ||
| IF | GTGCGTGCGTTTGCTTCGGA | 15–34 (+ sense) | 35 cycles of 94°C, 15 s; 54°C, 15 s; and 70°C, 25 s | |
| IR | GAGTACCAGTCACAAAGTCC | 1018–999 (- sense) | ||
| E | OF | CGGGGAGGGGACACAAATGG | 785–804 (+ sense) | 35 cycles of 94°C, 15 s; 52°C, 15 s; and 70°C, 30 s |
| OR | AGGCATAGTTGTCATACC | 2560–2543 (- sense) | ||
| IF | GTTGTGCTCCTGTGTTTGGC | 940–959 (+ sense) | 35 cycles of 94°C, 15 s; 56°C, 15 s; and 70°C, 30 s | |
| IR | CTCCATTCGTTCCGTGTC | 2496–2479 (- sense) | ||
| E-NS3 | OF (Mandal 2009) | AGAAAGATTGACAGTGATAGGAGAGC | 2202–2227 (+ sense) | 35 cycles of 94°C, 15 s; 56°C, 15 s; and 70°C, 60 s |
| OF (Saringe 2009) | CTGACAGTGATAGGAGAGCACGC | 2209–2231 (+ sense) | ||
| OR | GCTGCTGACGTAGGTCTCATTAG | 5097–5075 (- sense) | ||
| IF | TGCCTTCAACAGCATCTTCGG | 2301–2321 (+ sense) | 35 cycles of 94°C, 15 s; 56°C, 15 s; and 70°C, 60 s | |
| IR | CCCCACAACCACTCCCTG | 5052–5035 (- sense) | ||
| NS3 | OF | CGTGACGAGAGGAGCGGCG | 4761–4779 (+ sense) | 35 cycles of 94°C, 15 s; 68°C, 15 s; and 70°C, 30 s |
| OR | TGCGACGTGCCATGCCAG | 6258–6241 (- sense) | ||
| IF | CTACTGGGCTGATGTGAGG | 4809–4827 (+ sense) | 35 cycles of 94°C, 15 s; 52°C, 15 s; and 70°C, 30 s | |
| IR | GTGAGTCGATAGTGACCGG | 6182–6164 (- sense) | ||
| NS3-NS5 | OF | CTGACTTTGTGGTGACGACT | 5822–5841 (+ sense) | 35 cycles of 94°C, 15 s; 57°C, 15 s; and 70°C, 40 s |
| OR | TATGCCCTGACACTCATGACTG | 7973–7952 (- sense) | ||
| IF | GATGACAGTGGATTAGTGCAATGG | 6046–6069 (+ sense) | 35 cycles of 94°C, 15 s; 58°C, 15s ; and 70°C, 40 s | |
| IR | CCTTGAGGGTGGCATATCCGC | 7888–7868 (- sense) | ||
| NS4B-NS5 | OF | ATGAGTGGCGTGGTCAGGGG | 7582–7601 (+ sense) | 35 cycles of 94°C, 15 s; 58°C, 15 s; and 70°C, 50 s |
| OR | TCTCGCCGGTGAAAGTAGCTCAGC | 9980–9957 (- sense) | ||
| IF | AAGCCTGTGGGGGTTCCTGCC | 7602–7622 (+ sense) | 35 cycles of 94°C, 15 s; 54°C, 15 s; and 70°C, 50 s | |
| IR | GCGTCCGTCCTTCATCACTA | 9834–9815 (- sense) | ||
| NS5-3′NCR | OF | ACACCCTCACCAACATAAA | 9500–9518 (+ sense) | 25 cycles of 95°C, 20 s; 55°C, 15 s; and 68°C, 37 s |
| OR | GGGTGTTTTTCCGAGTCAC | 11138–11120 (- sense) | ||
| IF | CTAGTGATGAAGGACGGACG | 9814–9833 (+ sense) | 25 cycles of 95°C, 20 s; 55°C, 15 s; and 68°C, 37 s | |
| IR | CACACATCACCTCCTTGT | 11122–11105 (- sense) |
All the primers – outer forward (OF), outer reverse (OR), inner forward (IF), and inner reverse (IR) were identical for Saringe 2009 - and Mandal 2009 except E-NS3 OF. The nucleotide positions (nt) are related to the strain Toro 2003.