Table 1. Post-transcriptional regulation of ‘lacZ translational fusions by GacA and RsmE: impact of mutations in SD region of mRNAs.
| β-Galactosidase activity (× 103 Miller Units)b | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CHA0/ | CHA0/ | Induction | Repression | |||||||||
| Plasmida | 5′ RNA leader sequence | Genotype | CHA0 | CHA89 | pME6001 | pME6851 | factor | factor | ||||
| (wild type) | (gacA) | (vector control) | (rsmE2+) | (GacA) | (RsmE) | |||||||
| pME6533 | …GUACCCCAUUCAUUUUUCACGGAUGAACCCAGCAUG… | hcnA | 10.0 ± 1.0 | 0.35 ± 0.01 | 5.0 ± 0.4 | 1.00 ± 0.15 | 28 | 5 | ||||
| pME9512c | …GUACCCCAUUCAUUUUUCACGGA-GAACCCAGCAUG… | hcnA ΔU13 | 29.0 ± 1.5 | 22.0 ± 2.1 | 22.0 ± 1.5 | 25.0 ± 2.0 | 1.3 | 0.9 | ||||
| pME10001c | …GUACCCCAUUCAUUUUUCAGGGA-GAACCCAGCAUG… | hcnA C9G ΔU13 | 19.0 ± 1.0 | 7.0 ± 0.8 | 12.0 ± 0.5 | 9.5 ± 0.5 | 2.7 | 1.3 | ||||
| pME10002c | …GUACCCCAUUCAUUUUUCAGGAA-GAACCCAGCAUG… | hcnA C9G G11A | 28.0 ± 0.5 | 11.0 ± 1.7 | 18.0 ± 1.0 | 15.0 ± 1.0 | 2.5 | 1.2 | ||||
| ΔU13 | ||||||||||||
| pME6628 | …GUACCCCAUUCAUUUUUCGCGGAUGAACCCAGCAUG… | hcnA A8G | 4.6 ± 0.5 | 4.4 ± 0.2 | 2.40 ± 0.05 | 3.6 ± 0.2 | 1 | 0.7 | ||||
| pME10102 | …GUACCCCAUUCAUUUUUCGCGGACGAACCCAGCAUG… | hcnA A8G U13C | 6.2 ± 0.1 | 6.5 ± 0.1 | 4.5 ± 0.2 | 4.3 ± 0.3 | 1 | 1 | ||||
| pME9524 | …GUACCCCAGUGCGCCUAACAGGGAGUGGGGCAUG… | pltA | 0.36 ± 0.03 | 0.030 ± 0.005 | 0.19 ± 0.01 | 0.060 ± 0.004 | 12 | 3.2 | ||||
| pME9525 | …GUACCCCAGUGCGCCUAACAGGGAUGUGGGGCAUG… | pltA +U13 | 0.17 ± 0.01 | 0.012 ± 0.001 | 0.075 ± 0.004 | 0.012 ± 0.002 | 14 | 6.2 | ||||
| pME10101 | …GUACCCCAGUGCGCCUAACAAGGAGUGGGGCAUG… | pltA G9A | 0.40 ± 0.05 | 0.05 ± 0.01 | 0.13 ± 0.02 | 0.050 ± 0.005 | 8 | 2.6 | ||||
| pME6702 | …UCUGAAAAGAAUGGAAUCAAGAGGAAAAUG… | phlA | 1.90 ± 0.30 | 0.35 ± 0.05 | 0.90 ± 0.13 | 0.40 ± 0.05 | 5.4 | 2.2 | ||||
| pME6737 | …UCUGAAAAGACUGGAAUCAAGAGGAAAAUG… | phlA A8C | 2.90 ± 0.26 | 2.50 ± 0.15 | 0.90 ± 0.08 | 1.80 ± 0.20 | 1.2 | 0.5 | ||||
| pME9536d | …GUACCUUCUGAAAAGAAUGGAAUCAAGAGGAGCAUG… | phlA | 0.40 ± 0.08 | 0.12 ± 0.01 | 0.18 ± 0.015 | 0.14 ± 0.01 | 3.3 | 1.3 | ||||
| pME9537cd | …GUACCUUCUGAAAAGAAUGGA-UCAAGAGGAGCAUG… | phlA ΔA101 | 0.37 ± 0.01 | 0.32 ± 0.05 | 0.28 ± 0.035 | 0.32 ± 0.03 | 1.1 | 0.9 | ||||
a Bold plasmid names correspond to plasmids containing the indicated RNA sequence inserted into the KpnI and SphI restriction sites (in italics) of the hcnA leader of pME6533. bβ-Galactosidase expression of the reporter fusions was measured in P. fluorescens strains CHA0 (wild-type), CHA89 (gacA::Kmr), CHA0/pME6001 (vector control) and CHA0/pME6851 (pME6001 overexpressing rsmE) when the cells reached an OD600 of 3.0 and was determined in triplicate ± standard deviation. The GacA induction factor was calculated as the ratio of the expression in CHA0 and that in CHA89. The RsmE repression factor was calculated as the ratio of the expression in CHA0/pME6001 and that in CHA0/pME6851, respectively. cMeans no nucleotide. dIn pME9536 and pME9537, the tac promoter of pME6702 was exchanged against the hcnA promoter.