Table 2.

PCR primer combinations used to amplify deletion breakpoint junction

PCR	Primer ID	Primer F sequence	Primer ID	Primer R sequence	Distance (kb)	Amplicon size (kb)
1	5p1-F	aaacgggaaaggggatacat	3p3-R	ttgcccacacctaggtaaaga	21.5	1.3
2	5p1-F	aaacgggaaaggggatacat	3p2-R	acatcatggaagccttggtc	20.5	No
3	5p1-F	aaacgggaaaggggatacat	3p1-R	ccacctggatttggaagaaa	19.2	No

These PCR primer sets were used to amplify a genomic DNA fragment that could only be created by the deletion event.