TABLE 1.
Plasmids and primers used in this studya
| Plasmid or primer | Descriptionb | Reference |
|---|---|---|
| Plasmids | ||
| pT7Blue | ColE1 ori; Apr | Novagen |
| pHP45Ωkan | Plasmid carrying Kmr cassette with transcriptional terminators at each end; Apr Kmr | 8 |
| pCP11 | E. coli-F. johnsoniae shuttle plasmid; Apr (Emr) | 25 |
| pCP23 | E. coli-F. johnsoniae shuttle plasmid; Apr (Tcr) | 1 |
| pCP26 | E. coli-F. johnsoniae shuttle cosmid; Kmr Tcr (Emr) | 20 |
| pCP500 | Cosmid clone carrying gldI; Tcr (Emr) | This study |
| pCP507 | Cosmid clone carrying gldI; Tcr (Emr) | This study |
| pMM258 | 6.3-kbp SacI fragment of pCP500 (spanning ppiB, fjo20, and fjo21) in pCP11; Apr Tcr (Emr) | This study |
| pMM259 | 6.6-kbp SacI fragment of pCP507 (spanning fjo19 and gldI) in pCP11; Apr Tcr (Emr) | This study |
| pMM268 | 2.3-kbp EcoRI-EcoRV fragment of pMM259 (spanning fjo19) in pCP11; Apr (Emr) | This study |
| pMM291 | 1,032-bp fragment spanning gldI in pCP11; Apr (Emr) | This study |
| pMM292 | Identical to pMM291 except that gldI is inserted in the opposite orientation; Apr (Emr) | This study |
| pMM296 | pMM291 with the Kmr cassette from pHP45Ωkan inserted upstream of gldI; Apr Kmr (Emr) | This study |
| pMM297 | Identical to pMM296 except that the Kmr cassette is inserted in the opposite orientation; Apr Kmr (Emr) | This study |
| pTB39 | Recombinant gldB-his in pCP23; expresses GldI with a carboxy-terminal His tag; Apr (Tcr) | 24 |
| pTB45 | Recombinant gldI-his in pCP23; expresses GldI with a carboxy-terminal His tag; Apr (Tcr) | This study |
| Primers | ||
| 459 | 5′ GAATAAAACGAGCTAACGGC 3′; primer used for construction of gldI-containing plasmids pMM291 and pMM292 | |
| 476 | 5′ TCTTACATGACTTTGACTCAGG 3′; primer used for construction of gldI-containing plasmids and pTB45 | |
| 574 | 5′ TTATTAATGATGATGATGATGATGATGATGTGGGTTTAATGTATCTTTTTTAGTTTGAGCTGC 3′; primer used during construction of pTB45 |
a
Antibiotic resistance phenotypes are indicated as follows: Apr, ampicillin resistance; Emr, erythromycin resistance; Kmr, kanamycin resistance; Tcr, tetracycline resistance. Unless indicated otherwise, antibiotic resistance phenotypes are those expressed in E. coli. Antibiotic resistance phenotypes listed in parentheses are those expressed in F. johnsoniae but not in E. coli.
b
For primers, both the sequence and description are given.