Table 1.
Primers used to generate probes for RNA dot-blot hybridizations.
| Locus Tag a | Coding sequence ID | Enzyme commission number | F primer | R primer | Amplicon |
|---|---|---|---|---|---|
| Swit_1793 | NO-forming nitrite reductase (nirK) | EC:1.7.2.1 | ctgaccgcgaaggaagtatc | catggtcgacgatcacattg | 742 bp |
| Swit_5203 (p) | Nitric oxide dioxygenase (hmp) | EC:1.14.12.17 | tcgagcttgtccacattctg | attgtctccccaaaccatga | 210 bp |
| Swit_R0031 | 16S rRNA | untranslated | gtacaaggcctgggaacgta | tttatcgcctgaggatgagc | 1159 bp |
| *Swit_5200 (p) | Nitric oxide reductase (norZ) | EC:1.7.5.2 | ccaacgccaatactcaacct | cagcatttctacggcatcaa | 513 bp |
| *Swit_4614 (ch) | Nitric oxide reductase (norZ) | EC:1.7.5.2 | gtggtgcccgagaaatagag | gccagagcttctacggtgtc | 703 bp |
a
Significant difference between atmospheric and reduced O2 for wildtype (WT) cultures incubated with the same concentration of NaNO2.
(p), encoded on plasmid; (ch), encoded on chromosome.
*
Swit_4614 and Swit_5200 share 54% amino acid sequence identity based on BLAST.
Primers were designed using Primer 3 Input 0.4.0 software (Rozen and Skaletsky, 2000) against the full CDS's from the complete genome sequence of Sphingomonas wittichii RW1, which includes a single circular chromosome and two megaplasmids (Genbank accession: CP000699–CP000701).