Table 1. HRP labelled oligonucleotide probes used in this study.
Probea | Target group | Probe sequence (5′-3′) | Reference |
EUB338I | Most but not all Bacteria | GCTGCCTCCCGTAGGAGT | [16] |
EUB338II | Planctomycetes | GCAGCCACCCGTAGGTGT | [17] |
EUB338III | Verrucomicrobiales | GCTGCCACCCGTAGGTGT | [17] |
ALF968 | Alphaproteobacteria | GGTAAGGTTCTGCGCGTT | [18] |
BET42a | Betaproteobacteria | GCCTTCCCACTTCGTTT | [19] |
GAM42a | Gammaproteobacteria | GCCTTCCCACATCGTTT | [19] |
DELTA495a | Most Deltaproteobacteria | AGTTAGCCGGTGCTTCCT | [20] |
DELTA495b | Deltaproteobacteria | AGTTAGCCGGCGCTTCCT | [20] |
DELTA495c | Deltaproteobacteria | AATTAGCCGGTGCTTCCT | [20] |
EPSY914 | Epsilonproteobacteria | GGTCCCCGTCTATTCCTT | [21] |
CF319a | Bacteroidetes | TGGTCCGTGTCTCAGTAC | [22] |
HGC69a | Actinobacteria (high G+C content−Gram+bacteria) | TATAGTTTACCACCGCCGT | [23] |
LGC354a | Firmicutes (low G+C content−Gram+bacteria) | TGGAAGATTCCCTACTGC | [24] |
LGC354b | Firmicutes (low G+C content−Gram+bacteria) | CGGAAGATTCCCTACTGC | [24] |
LGC354c | Firmicutes (low G+C content−Gram+bacteria) | CCGAAGATTCCCTACTGC | [24] |
CYA664 | Most Cyanobacteria | GGAATTCCCTCTGCCCC | [25] |
CYA762 | Most Cyanobacteria | CGCTCCCCTAGCTTTCGTC | [25] |
ARCH915 | Archaea | GTGCTCCCCCGCCAATTCCT | [26] |
NON338 | Negative control probe | ACTCCTACGGGAGGCAGC | [27] |
Probes EUB338I, EUB338II and EUB338III were equimolarly mixed together to obtain the EUB-mix; the probes LGC354a, LGC354b and LGC354c were equimolarly mixed together to obtain the LGC-mix; Probes DELTA495a, DELTA495b and DELTA495c were equimolarly mixed together to obtain the DELTA-mix; Probes CYA664 and CYA762 were equimolarly mixed together to obtain the CYA-mix.