Table 1.
Strains and oligonucleotides used in this study
Strain | Relevant genotype or characteristic | Source or reference |
---|---|---|
MG1655 | Wild type | Blattner et al (3) |
ΔfruR | ΔfruR in MG1655 | This study |
MG1655ΔlacY | ΔlacY in MG1655 | Klumpp et al (11) |
MG1655ΔlacY ΔfruR | ΔlacY ΔfruR in MG1655 | This study |
MG1655 (Pcrp-lacZ) | MG1655ΔlacY carrying Pcrp-lacZ at the lac locus | This study |
MG1655 ΔfruR (Pcrp-lacZ) | ΔlacY ΔfruR carrying Pcrp-lacZ at the lac locus | This study |
MG1655 (PcrpOCra-lacZ) | ΔlacY carrying PcrpOCra-lacZ at the lac locus | This study |
MG1655 ΔfruR (PcrpOCra-lacZ) | ΔlacY ΔfruR carrying PcrpOCra-lacZ at the lac locus | This study |
Oligonucleotide | Sequence | Use |
fruR1-P1 | gtgaaactggatgaaatcgctcggctggcgggagtgtcgcggaccactgcgtgtaggctggagctgcttcg | fruR mutation |
fruR2-P2 | gctacggctgagcacgccgcggcgatagagattacgtttaatgcgcgttacatatgaatatcctccttag | fruR mutation |
Pcrp-Xho-F | atactcgagcttgcatttttgctactccactg | Cloning Pcrp into pKDT |
Pcrp-Bam-R | ttaggatccctggtgaataagcgtgctcttggatg | Cloning Pcrp into pKDT |
Pcrp-Z-P1 | gcatttacgttgacaccatcgaatggcgcaaaacctttcgcggtatgtgtaggctggagctgcttc | Integration of Pcrp-lacZ at the lac locus |
Pcrp-Z-P2 | gattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacctggtgaataagcgtgctcttggatg | Integration of Pcrp-lacZ at the lac locus |
Pcrp-F | gttttagcatagctttcgctttgtgtctcctggtgtctaacaggagcatg | Cra operator mutation in Pcrp region |
Pcrp-R | caccaggagacacaaagcgaaagc | Cra operator mutation in Pcrp region |