MG1655 |
Wild type |
Blattner et al (3) |
ΔfruR
|
ΔfruR in MG1655 |
This study |
MG1655ΔlacY
|
ΔlacY in MG1655 |
Klumpp et al (11) |
MG1655ΔlacY ΔfruR
|
ΔlacY ΔfruR in MG1655 |
This study |
MG1655 (Pcrp-lacZ) |
MG1655ΔlacY carrying Pcrp-lacZ at the lac locus |
This study |
MG1655 ΔfruR (Pcrp-lacZ) |
ΔlacY ΔfruR carrying Pcrp-lacZ at the lac locus |
This study |
MG1655 (PcrpOCra-lacZ) |
ΔlacY carrying PcrpOCra-lacZ at the lac locus |
This study |
MG1655 ΔfruR (PcrpOCra-lacZ) |
ΔlacY ΔfruR carrying PcrpOCra-lacZ at the lac locus |
This study |
Oligonucleotide |
Sequence |
Use |
fruR1-P1 |
gtgaaactggatgaaatcgctcggctggcgggagtgtcgcggaccactgcgtgtaggctggagctgcttcg |
fruR mutation |
fruR2-P2 |
gctacggctgagcacgccgcggcgatagagattacgtttaatgcgcgttacatatgaatatcctccttag |
fruR mutation |
Pcrp-Xho-F |
atactcgagcttgcatttttgctactccactg |
Cloning Pcrp into pKDT |
Pcrp-Bam-R |
ttaggatccctggtgaataagcgtgctcttggatg |
Cloning Pcrp into pKDT |
Pcrp-Z-P1 |
gcatttacgttgacaccatcgaatggcgcaaaacctttcgcggtatgtgtaggctggagctgcttc |
Integration of Pcrp-lacZ at the lac locus |
Pcrp-Z-P2 |
gattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacctggtgaataagcgtgctcttggatg |
Integration of Pcrp-lacZ at the lac locus |
Pcrp-F |
gttttagcatagctttcgctttgtgtctcctggtgtctaacaggagcatg |
Cra operator mutation in Pcrp region |
Pcrp-R |
caccaggagacacaaagcgaaagc |
Cra operator mutation in Pcrp region |