Table 1. Plasmids designed and used in this study.
| Plasmid | Description | Reference |
|---|---|---|
| pSEAP2-Control | Constitutive mammalian SEAP expression vector (PSV40-SEAP-pA). | Clontech, CA |
| pUC57 | pUC19-derived prokaryotic expression vector. | GeneScript, NJ |
| pCK25 | Constitutive mUTS expression vector (PhEF1α-mUTS-pA). | (6) |
| pCK189 | Constitutive VanA4 expression vector (PSV40-VanA4-pA). | (14) |
| pCK191 | Vanillic acid-inducible SEAP expression vector (PVanON8-SEAP-pA). | (14) |
| pDA43 | Tetracycline-repressible GLuc expression vector (PhCMV*-1-GLuc-pA). | (25) |
| pKR38 | Constitutive mammalian KstR-VP16 expression vector (PSV40-KstR-VP16-pA). | Unpublished |
| pKR80 | Constitutive mammalian KstR-KRAB expression vector (PhEF1α-KstR-KRAB-pA). | Unpublished |
| pMF111 | Tetracycline-repressible SEAP expression vector (PhCMV*-1-SEAP-pA). | (44) |
| pMG10 | Phloretin-repressible SEAP expression vector (PTtgR1-SEAP-pA). | (19) |
| pMG11 | Constitutive TtgA1 expression vector (PSV40-TtgA1-pA). | (19) |
| pSAM200 | Constitutive tTA expression vector (PSV40-tTA-pA). | (44) |
| pWW124 | γ-butyrolactone (SCB1)-repressible SEAP expression vector (PSPA-SEAP-pA). | (23) |
| pMX34 | Constitutive CTS1 expression vector (PhEF1α-CTS1-pA; CTS1, KRAB-CbaR). | This work |
| CbaR was PCR-amplified from pMX43 using oligonucleotides OMX49 (5′-gaatgatctctgggcgcgcATGCTGGCCCGTGACCCCCGGAAAAG-3′) and OMX48 (5′-ggccctctagattaCTCCTGAGGGCTCTCCCGATGCCAATG-3′), restricted with BssHII/XbaI and cloned into the corresponding sites (BssHII/XbaI) of pCK25. | ||
| pMX38 | Benzoic and vanillic acid-responsive SEAP expression vector (PCTA-O2-SEAP-pA; PCTA-O2, (OCbaR)2-PhCMVmin). OCbaR was PCR-amplified from pWW124 using oligonucleotides OMX33 (5′-ccacctgacgtcgacacaagttgctaaaccaacaacatgtttgacacaagttgctaaaccaacaacatccgcaaatTCGAGCTCGGTACCCGGGTCGAGT-3’) and OMX24 (5′-CTTGAGCACATAGCCTGGACCGTTTCCGTA-3′), restricted with AatII/EcoRI and cloned into the corresponding sites (AatII/EcoRI) of pWW124. | This work |
| pMX39 | Benzoic and vanillic acid-responsive SEAP expression vector (PCTS1-SEAP-pA; PCTS1, PSV40-OCbaR). OCbaRwas introduced by PCR-amplification of pSEAP2-Control with oligonucleotides OMX36 (5′-tagtaataagcttgaaagttgctaaaccaacaacatccgCCACCATGCTGCTGCTGCTGCTGCTGCTGGG-3′) and OMX24 (5′-CTTGAGCACATAGCCTGGACCGTTTCCGTA-3′), restricted with HindIII/PstI and cloned into the corresponding sites (HindIII/PstI) of pSEAP2-Control. | This work |
| pMX40 | Benzoic and vanillic acid-responsive SEAP expression vector (PCTS2-SEAP-pA; PCTS2, PSV40-(OCbaR)2). (OCbaR)2 was introduced by PCR-amplification of pSEAP2-Control with oligonucleotides OMX35 (5′-tagtaatAagcttgaaagttgctaaaccaacaacatgtttgacacaagttgctaaaccaacaacatccgCCACCATGCTGCTGCTGCTGCTGCTGCTGGG-3’) and OMX24 (5′-CTTGAGCACATAGCCTGGACCGTTTCCGTA-3′), restricted with HindIII/PstI and cloned into the corresponding sites (HindIII/PstI) of pSEAP2-Control. | This work |
| pMX41 | Benzoic and vanillic acid-responsive SEAP expression vector (PCTS3-SEAP-pA; PCTS3, PSV40-(OCbaR)3). (OCbaR)3 was introduced by PCR-amplification of pSEAP2-Control with oligonucleotides OMX43 (5′-caaaaagcttgaaagttgctaaaccaacaacatgtttgacacaagttgctaaaccaacaacatgtttgacacaagttgctaaaccaacaacatccgCCACCATGCTGCTGCTGCTGC-3′) and OMX24 (5′-CTTGAGCACATAGCCTGGACCGTTTCCGTA-3’), restricted with HindIII/PstI and cloned into the corresponding sites (HindIII/PstI) of pSEAP2-Control. | This work |
| pMX42 | Benzoic and vanillic acid-responsive SEAP expression vector (PCTS-O3P2-SEAP-pA; PCTS-O3P2, (OCbaR)3-PSV40-(OCbaR)2). Oligonucleotides OMX44 (5′-CTTGAAAGTTGCTAAACCAACAACATGTTTGACACAAGTTGCTAAACCAACAACATGTTTGACACAAGTTGCTAAACCAACAACACTATCGATAGGTACCGAGCTCTTA-3′) and OMX45 (5′-cgcgTAAG AGCTCGGTACCTATCGATAGTGTTGTTGGTTTAGCAACTTGTGTCAAACATGTTGTTGGTTTAGCAACTTGTGTCAAACATGTTGTTGGTTTAGCAACTTTCAAGgtac-3′) were annealed and cloned into the KpnI/MluI-restricted pMX39. | This work |
| pMX43 | Constitutive CTA expression vector (PSV40-CTA-pA; CTA, CbaR-VP16). | This work |
| Custom-designed mammalian codon-optimized cbaR was excised from pUC57 with NotI/BssHII and cloned into the corresponding sites (NotI/BssHII) of pKR38. | ||
| pMX45 | Constitutive CTS2 expression vector (PhEF1α-CTS2-pA; CTS2, CbaR-KRAB). | This work |
| Custom-designed mammalian codon-optimized cbaR was excised from pUC57 with NotI/BssHII and cloned into the corresponding sites (NotI/BssHII) of pKR80. | ||
| pMX78 | Vanillic acid-inducible GLuc expression vector (PVanON8-GLuc-pA). GLuc was excised from pDA43 using EcoRI/FseI and cloned into the corresponding sites (EcoRI/FseI) of pCK191. | This work |
Oligonucleotides: Restriction endonuclease-specific sites are underlined, annealing base pairs are indicated in capital letters and the operator module OCbaR is shown in bold.
Abbreviations: CbaR, Comamonas testosteroni BR60 repressor of the 3-chlorobenzoate catabolism; CTA, CbaR-derived benzoic and vanillic acid-dependent transactivator (CbaR-VP16); CTS1, CbaR-derived benzoic and vanillic acid-dependent transsilencer variant 1 (KRAB-CbaR); CTS2, CbaR-derived benzoic and vanillic acid-dependent transsilencer variant 2 (CbaR-KRAB); GLuc, Gaussia princeps luciferase; HucR,Deinococcus radiodurans uric acid-dependent repressor; KRAB, Krueppel-associated box protein of the human kox-1 gene; KstR, Mycobacterium tuberculosis repressor of the cholesterol catabolism; mUTS, mammalian urate-dependent transsilencer (KRAB-HucR); OCbaR, CbaR-specific operator; OPapRI, ScbR-specific operator; OTtgR, TtgA1-specific operator; pA, polyadenylation site; PCTA-O2, CTA-specific benzoic and vanillic acid-responsive promoter ((OCbaR)2-PhCMVmin); PCTS1, benzoic and vanillic acid-responsive promoter (PSV40-OCbaR); PCTS2, benzoic and vanillic acid-responsive promoter (PSV40-(OCbaR)2); PCTS3, benzoic and vanillic acid-responsive promoter (PSV40-(OCbaR)3); PCTS-O3P2, benzoic and vanillic acid-responsive promoter ((OCbaR)3-PSV40-(OCbaR)2); PhEF1α, human elongation factor 1α promoter; PhCMV, human cytomegalovirus immediate early promoter; PhCMVmin, minimal version of PhCMV; PhCMV*-1, tetracycline-responsive promoter (tetO7-PhCMVmin); PSPA, γ-butyrolactone (SCB1)-repressible promoter (OPapRI-PhCMVmin); PSV40, simian virus 40 promoter; PTtgR1, phloretin-responsive promoter (OTtgR-PhCMVmin); PVanON8 vanillic acid-inducible promoter (PhCMV-VanO8); SEAP, human placental secreted alkaline phosphatase; SCB1, 2-(1′-hydroxy-6-methylheptyl)-3-(hydroxymethyl)-butanolide; ScbR, Streptomyces coelicolor γ-butyrolactone (SCB1)-specific quorum-sensing receptor; tetO, TetR-specific operator; TetR, Escherichia coli Tn10-derived tetracycline-dependent repressor of the tetracycline resistance gene; tTA, tetracycline-dependent transactivator (TetR-VP16); TtgA1, phloretin-dependent transactivator (TtgR-VP16); VanA4, VanR-derived vanillic acid-dependent transsilencer (VanR-KRAB); VanO, VanR-specific operator. VanR, vanillic acid-dependent repressor of the Caulobacter crescentus VanAB gene cluster; VP16, Herpes simplex virus-derived transactivation domain.