Skip to main content
. 2014 Jul 16;42(14):e116. doi: 10.1093/nar/gku545

Table 1. Plasmids designed and used in this study.

Plasmid Description Reference
pSEAP2-Control Constitutive mammalian SEAP expression vector (PSV40-SEAP-pA). Clontech, CA
pUC57 pUC19-derived prokaryotic expression vector. GeneScript, NJ
pCK25 Constitutive mUTS expression vector (PhEF1α-mUTS-pA). (6)
pCK189 Constitutive VanA4 expression vector (PSV40-VanA4-pA). (14)
pCK191 Vanillic acid-inducible SEAP expression vector (PVanON8-SEAP-pA). (14)
pDA43 Tetracycline-repressible GLuc expression vector (PhCMV*-1-GLuc-pA). (25)
pKR38 Constitutive mammalian KstR-VP16 expression vector (PSV40-KstR-VP16-pA). Unpublished
pKR80 Constitutive mammalian KstR-KRAB expression vector (PhEF1α-KstR-KRAB-pA). Unpublished
pMF111 Tetracycline-repressible SEAP expression vector (PhCMV*-1-SEAP-pA). (44)
pMG10 Phloretin-repressible SEAP expression vector (PTtgR1-SEAP-pA). (19)
pMG11 Constitutive TtgA1 expression vector (PSV40-TtgA1-pA). (19)
pSAM200 Constitutive tTA expression vector (PSV40-tTA-pA). (44)
pWW124 γ-butyrolactone (SCB1)-repressible SEAP expression vector (PSPA-SEAP-pA). (23)
pMX34 Constitutive CTS1 expression vector (PhEF1α-CTS1-pA; CTS1, KRAB-CbaR). This work
CbaR was PCR-amplified from pMX43 using oligonucleotides OMX49 (5′-gaatgatctctgggcgcgcATGCTGGCCCGTGACCCCCGGAAAAG-3′) and OMX48 (5′-ggccctctagattaCTCCTGAGGGCTCTCCCGATGCCAATG-3′), restricted with BssHII/XbaI and cloned into the corresponding sites (BssHII/XbaI) of pCK25.
pMX38 Benzoic and vanillic acid-responsive SEAP expression vector (PCTA-O2-SEAP-pA; PCTA-O2, (OCbaR)2-PhCMVmin). OCbaR was PCR-amplified from pWW124 using oligonucleotides OMX33 (5′-ccacctgacgtcgacacaagttgctaaaccaacaacatgtttgacacaagttgctaaaccaacaacatccgcaaatTCGAGCTCGGTACCCGGGTCGAGT-3’) and OMX24 (5′-CTTGAGCACATAGCCTGGACCGTTTCCGTA-3′), restricted with AatII/EcoRI and cloned into the corresponding sites (AatII/EcoRI) of pWW124. This work
pMX39 Benzoic and vanillic acid-responsive SEAP expression vector (PCTS1-SEAP-pA; PCTS1, PSV40-OCbaR). OCbaRwas introduced by PCR-amplification of pSEAP2-Control with oligonucleotides OMX36 (5′-tagtaataagcttgaaagttgctaaaccaacaacatccgCCACCATGCTGCTGCTGCTGCTGCTGCTGGG-3′) and OMX24 (5′-CTTGAGCACATAGCCTGGACCGTTTCCGTA-3′), restricted with HindIII/PstI and cloned into the corresponding sites (HindIII/PstI) of pSEAP2-Control. This work
pMX40 Benzoic and vanillic acid-responsive SEAP expression vector (PCTS2-SEAP-pA; PCTS2, PSV40-(OCbaR)2). (OCbaR)2 was introduced by PCR-amplification of pSEAP2-Control with oligonucleotides OMX35 (5′-tagtaatAagcttgaaagttgctaaaccaacaacatgtttgacacaagttgctaaaccaacaacatccgCCACCATGCTGCTGCTGCTGCTGCTGCTGGG-3’) and OMX24 (5′-CTTGAGCACATAGCCTGGACCGTTTCCGTA-3′), restricted with HindIII/PstI and cloned into the corresponding sites (HindIII/PstI) of pSEAP2-Control. This work
pMX41 Benzoic and vanillic acid-responsive SEAP expression vector (PCTS3-SEAP-pA; PCTS3, PSV40-(OCbaR)3). (OCbaR)3 was introduced by PCR-amplification of pSEAP2-Control with oligonucleotides OMX43 (5′-caaaaagcttgaaagttgctaaaccaacaacatgtttgacacaagttgctaaaccaacaacatgtttgacacaagttgctaaaccaacaacatccgCCACCATGCTGCTGCTGCTGC-3′) and OMX24 (5′-CTTGAGCACATAGCCTGGACCGTTTCCGTA-3’), restricted with HindIII/PstI and cloned into the corresponding sites (HindIII/PstI) of pSEAP2-Control. This work
pMX42 Benzoic and vanillic acid-responsive SEAP expression vector (PCTS-O3P2-SEAP-pA; PCTS-O3P2, (OCbaR)3-PSV40-(OCbaR)2). Oligonucleotides OMX44 (5′-CTTGAAAGTTGCTAAACCAACAACATGTTTGACACAAGTTGCTAAACCAACAACATGTTTGACACAAGTTGCTAAACCAACAACACTATCGATAGGTACCGAGCTCTTA-3′) and OMX45 (5′-cgcgTAAG AGCTCGGTACCTATCGATAGTGTTGTTGGTTTAGCAACTTGTGTCAAACATGTTGTTGGTTTAGCAACTTGTGTCAAACATGTTGTTGGTTTAGCAACTTTCAAGgtac-3′) were annealed and cloned into the KpnI/MluI-restricted pMX39. This work
pMX43 Constitutive CTA expression vector (PSV40-CTA-pA; CTA, CbaR-VP16). This work
Custom-designed mammalian codon-optimized cbaR was excised from pUC57 with NotI/BssHII and cloned into the corresponding sites (NotI/BssHII) of pKR38.
pMX45 Constitutive CTS2 expression vector (PhEF1α-CTS2-pA; CTS2, CbaR-KRAB). This work
Custom-designed mammalian codon-optimized cbaR was excised from pUC57 with NotI/BssHII and cloned into the corresponding sites (NotI/BssHII) of pKR80.
pMX78 Vanillic acid-inducible GLuc expression vector (PVanON8-GLuc-pA). GLuc was excised from pDA43 using EcoRI/FseI and cloned into the corresponding sites (EcoRI/FseI) of pCK191. This work

Oligonucleotides: Restriction endonuclease-specific sites are underlined, annealing base pairs are indicated in capital letters and the operator module OCbaR is shown in bold.

Abbreviations: CbaR, Comamonas testosteroni BR60 repressor of the 3-chlorobenzoate catabolism; CTA, CbaR-derived benzoic and vanillic acid-dependent transactivator (CbaR-VP16); CTS1, CbaR-derived benzoic and vanillic acid-dependent transsilencer variant 1 (KRAB-CbaR); CTS2, CbaR-derived benzoic and vanillic acid-dependent transsilencer variant 2 (CbaR-KRAB); GLuc, Gaussia princeps luciferase; HucR,Deinococcus radiodurans uric acid-dependent repressor; KRAB, Krueppel-associated box protein of the human kox-1 gene; KstR, Mycobacterium tuberculosis repressor of the cholesterol catabolism; mUTS, mammalian urate-dependent transsilencer (KRAB-HucR); OCbaR, CbaR-specific operator; OPapRI, ScbR-specific operator; OTtgR, TtgA1-specific operator; pA, polyadenylation site; PCTA-O2, CTA-specific benzoic and vanillic acid-responsive promoter ((OCbaR)2-PhCMVmin); PCTS1, benzoic and vanillic acid-responsive promoter (PSV40-OCbaR); PCTS2, benzoic and vanillic acid-responsive promoter (PSV40-(OCbaR)2); PCTS3, benzoic and vanillic acid-responsive promoter (PSV40-(OCbaR)3); PCTS-O3P2, benzoic and vanillic acid-responsive promoter ((OCbaR)3-PSV40-(OCbaR)2); PhEF1α, human elongation factor 1α promoter; PhCMV, human cytomegalovirus immediate early promoter; PhCMVmin, minimal version of PhCMV; PhCMV*-1, tetracycline-responsive promoter (tetO7-PhCMVmin); PSPA, γ-butyrolactone (SCB1)-repressible promoter (OPapRI-PhCMVmin); PSV40, simian virus 40 promoter; PTtgR1, phloretin-responsive promoter (OTtgR-PhCMVmin); PVanON8 vanillic acid-inducible promoter (PhCMV-VanO8); SEAP, human placental secreted alkaline phosphatase; SCB1, 2-(1′-hydroxy-6-methylheptyl)-3-(hydroxymethyl)-butanolide; ScbR, Streptomyces coelicolor γ-butyrolactone (SCB1)-specific quorum-sensing receptor; tetO, TetR-specific operator; TetR, Escherichia coli Tn10-derived tetracycline-dependent repressor of the tetracycline resistance gene; tTA, tetracycline-dependent transactivator (TetR-VP16); TtgA1, phloretin-dependent transactivator (TtgR-VP16); VanA4, VanR-derived vanillic acid-dependent transsilencer (VanR-KRAB); VanO, VanR-specific operator. VanR, vanillic acid-dependent repressor of the Caulobacter crescentus VanAB gene cluster; VP16, Herpes simplex virus-derived transactivation domain.