TABLE 1.

Strains and plasmids

Strain or plasmid	Characteristic	Sequencea	Source/reference
Strains
C. botulinum ATCC 3502	Parent strain		ATCC, Manassas, VA
C. botulinum ATCC 3502 sigF522s::CT	ClosTron insertional mutant of sigF in sense orientation	ATACATCAAGATGATGGAGCACCAGTTTTG*CTTATTGATAAAATA	This study
C. botulinum ATCC 3502 sigF487a::CT	ClosTron insertional mutant of sigF in antisense orientation	CTGGTGCTCCATCATCTTGATGTATAACAT*CATATAAATATTGGG	This study
C. botulinum ATCC 3502 sigE441s::CT	ClosTron insertional mutant of sigE in sense orientation	TTAAATATTGATTGGGATGGAAATGAGCTA*TTACTTTCAGATATA	This study
C. botulinum ATCC 3502 sigE385a::CT	ClosTron insertional mutant of sigE in antisense orientation	TTAAAGGTTCATAAAAGGATATTTCTGCTT*TTACTTTACTATTTC	This study
C. botulinum ATCC 3502 sigG546s::CT	ClosTron insertional mutant of sigG in sense orientation	ATATATCATGATGGTGGTGACGCCATATTT*GTTATGGATCAAATA	This study
C. botulinum ATCC 3502 sigG457a::CT	ClosTron insertional mutant of sigG in antisense orientation	TAGCGTCTAAAGCAAACACTACCTCTTCTC*TTGGTAGTTCTAATT	This study
E. coli 5-alpha	Chemically competent cloning strain		Invitrogen, Carlsbad, CA
E. coli CA434	Conjugation donor strain containing R702 plasmid		39
Plasmids
pMTL007C-E2	Clostridia mutagenesis vector		37
pMTL007C-E2::Cbo-sigF522s::CT	pMTL007C-E2 targeting sigF in sense orientation		This study; DNA 2.0
pMTL007C-E2::Cbo-sigF487a::CT	pMTL007C-E2 targeting sigF in antisense orientation		This study; DNA 2.0
pMTL007C-E2::Cbo-sigE441s::CT	pMTL007C-E2 targeting sigE in sense orientation		This study; DNA 2.0
pMTL007C-E2::Cbo-sigE385a::CT	pMTL007C-E2 targeting sigE in antisense orientation		This study; DNA 2.0
pMTL007C-E2::Cbo-sigG546s::CT	pMTL007C-E2 targeting sigG in sense orientation		This study; DNA 2.0
pMTL007C-E2::Cbo-sigG457a::CT	pMTL007C-E2 targeting sigG in antisense orientation		This study; DNA 2.0

^aClosTron insertion sites are represented by asterisks.