. 2014 Aug;58(8):4399–4403. doi: 10.1128/AAC.02555-14

TABLE 1.

Primers and PCR conditions used in this work

Assay type and primer	Sequence (5′ to 3′)^a	Cycling conditions^b
Conventional PCR
AvaI_pmrAB_F	TCCCTCGGGTCATTACAGCCTGATCGTGCTGGATCTCG	95°C for 30 s, 62°C for 30 s, 72°C for 180 s
EcoRI_pmrAB _R	CCGGAATTCTCGTCCTGCTTGCCAGATAACAAACATTT	95°C for 30 s, 62°C for 30 s, 72°C for 180 s
qRT-PCR
pmrA_F	GCAGGGGTTAATTCTGGCGATGC	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
pmrA_R	CGATAGCGCGGCTTCGTGC	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
pmrB_F	GGCCGTCGTCTCTGGCGATG	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
pmrB_R	GGGCTGTAGCGGTGAGCATTC	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
pmrK_F2	CGCTGAATATGCTCGACCCAGAAG	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
pmrK_R2	GCTGGCGGTAATCGTCTGTACG	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
rpsL13_F	GCCGTACTTGGAGCGAGCCTG	95°C for 10 s, 52°C for 5 s, 72°C for 5 s
rpsL14_F	CCGTGGCGGTCGTGTTAAAGA	95°C for 10 s, 52°C for 5 s, 72°C for 5 s

Restriction sites added for cloning purposes in some primers are underlined.

All conventional PCRs included an initial denaturation step of 180 s at 95°C, 30 cycles of denaturation, annealing, and extension at the reported temperatures for the reported times, and a final extension step of 300 s at 72°C; all qRT-PCRs included an initial denaturation step of 300 s at 95°C and 40 cycles of amplification.