Table 1.
Oligodeoxy nucleotide primers used in MSP analysis of bax gene DNA methylation status [21]
| Primer | Sequence (5'—3') | Gen Bank accession no. | CGI Location | Tanneal, °C | Amplicon size (length in bp) |
|---|---|---|---|---|---|
| Sense | M- GAGGTAGGTGCGGTTACGTG | NC_000019.9 | 5'+ body | 56 | 102 |
| Antisense | M- AATCACGTAAAAACCCCGCT | ||||
| Sense | U- GGTGTTGTGGGGTAGTGGTT | 63 | 118 | ||
| Antisense | U- ACCACCTCTCACCAAATCCA |
M: Methylated sequences; U: Unmethylated sequences; CGI Location: location of the CpG island with respect to the transcription start site of its associated gene.