. 2014 Sep 5;5:427. doi: 10.3389/fmicb.2014.00427

Table 1.

List of selected transcripts induced in olive aerial tissues upon P. fluorescens PICF7 colonization used in qRT-PCR experiments.

Clone ID	Putative gene	Process	Primer pair	Amplicon length (bp)	Linear equation (1)	R²(1)	PCR efficiency(1)
AU12-D10T7	1-Aminocyclopropane-1-carboxylate oxidase	Ethylene biosynthesis	Fw: CTCAAGTTGATCCCCAAT	231	Y = −3.430 + 29.271	0.994	95.7
AU12-D10T7	1-Aminocyclopropane-1-carboxylate oxidase	Ethylene biosynthesis	Rv: GCATTCCATGGCTCTAAA	231	Y = −3.430 + 29.271	0.994	95.7
AU03-E02T7	Phenylananine ammonia-lyase	Phenylpropanoids biosynthesis	Fw: ACATAGGAGGACCAAACAA	280	Y = −3.394 + 29.944	0.991	97.1
AU03-E02T7	Phenylananine ammonia-lyase	Phenylpropanoids biosynthesis	Rv: GTAGGATAAAGGGACAAGAT	280	Y = −3.394 + 29.944	0.991	97.1
AU06-H07T7	Catalase	Oxidation-reduction	Fw: CCCAGGATCTCTACGATT	273	Y = −3.371 + 22.018	0.993	98.0
AU06-H07T7	Catalase	Oxidation-reduction	Rv: TCTGGAGCATCTTGTCAT	273	Y = −3.371 + 22.018	0.993	98.0
AU13-A07T7	Lipoxygenase 2	Linolenic acid metabolism	Fw: GAGACATCACCAATCCAT	141	Y = −3.413 + 29.253	0.989	96.3
AU13-A07T7	Lipoxygenase 2	Linolenic acid metabolism	Rv: CCAGCACCACATCTATTT	141	Y = −3.413 + 29.253	0.989	96.3
AU04-G10T7	Acetone cyanohydrin lyase	Salicylic acid-binding protein 2	Fw: GAAAGAGATGGAGACGGAA	246	Y = −3.141 + 32.360	0.994	108.2
AU04-G10T7	Acetone cyanohydrin lyase	Salicylic acid-binding protein 2	Rv: ACACAGGGAAATGCATCAAA	246	Y = −3.141 + 32.360	0.994	108.2
AF545569 (2)	Olea europea beta-actin (act1)	Cytoskeletal integrity	Fw: GCTTGCTTATGTTGCTCTCGAC	308	Y = −3.341 + 28.428	0.990	99.2
AF545569 (2)	Olea europea beta-actin (act1)	Cytoskeletal integrity	Rv: TGATTTCCTTGCTCATACGGTC	308	Y = −3.341 + 28.428	0.990	99.2

For all transcripts, relative expression (RE) analysis was repeated at least two times in independent qRT-PCR experiments (see text and Figure 4). Clone ID, gene name, biological process, primers sequences, amplicon length, linear equations, correlation coefficients (R²), and PCR efficiencies are indicated (Fw: Forward; Rv: Reverse). AU, Arbequina aerial tissues induced gene; (1) Linear equation R² coefficient and PCR efficiency correspond to a representative qRT-PCR assay performed (2): olive act-1 gene used as reference to normalize relative expression (Gene Bank Accession Number). doi: 10.1371/journal.pone.0048646.t003.