Skip to main content
Memórias do Instituto Oswaldo Cruz logoLink to Memórias do Instituto Oswaldo Cruz
. 2014 Jul 3;109(4):502–505. doi: 10.1590/0074-0276130601

The mazEF toxin-antitoxin system as a novel antibacterial target in Acinetobacter baumannii

Sobhan Ghafourian 1,2,+, Liam Good 3, Zamberi Sekawi 1, Rukman Awang Hamat 1, Sara Soheili 1, Nourkhoda Sadeghifard 2, Vasanthakumari Neela 1,+
PMCID: PMC4155857  PMID: 25004148

Abstract

Although analysis of toxin-antitoxin (TA) systems can be instructive, to date, there is no information on the prevalence and identity of TA systems based on a large panel of Acinetobacter baumannii clinical isolates. The aim of the current study was to screen for functional TA systems among clinical isolates of A. baumannii and to identify the systems’ locations. For this purpose, we screened 85 A. baumannii isolates collected from different clinical sources for the presence of the mazEF, relBE and higBA TA genes. The results revealed that the genes coding for the mazEF TA system were commonly present in all clinical isolates of A. baumannii. Reverse transcriptase-polymerase chain reaction analysis showed that transcripts were produced in the clinical isolates. Our findings showed that TA genes are prevalent, harboured by chromosomes and transcribed within A. baumannii. Hence, activation of the toxin proteins in the mazEF TA system should be investigated further as an effective antibacterial strategy against this bacterium.

Keywords: toxin-antitoxin systems, Acinetobacter baumannii, antibacterial target


The use of antibiotics for the treatment of infection in humans and animals over the past decades has led to the evolution of multiple drug resistance in microbes. Resistance to antibiotics develops through mutations of target sites or the acquisition of antibiotic-resistant genes from other pathogens. To date, multiple drug resistance has been the greatest challenge in the management of infectious diseases. Although studies on the development of new antibiotics are rapidly progressing, the identification of new drug targets in microbes is also very important for effective infection control. Currently, resistance to antimicrobial agents seems to be a problematic issue worldwide. Thus, finding new antibiotics as a strategy to continue antibiotic therapy seems urgent (Davies & Webb 1998, Schlessinger & Eisenstein 1999).

A toxin-antitoxin (TA) system is a set of two or more closely linked genes that together encode both a protein “poison” and a corresponding “antidote”. TA systems were first described in 1982 (Ghafourian et al. 2014). Detailed insights into their functions and mechanisms of action have been gained over the last two decades and have led to several interesting conclusions about the importance of such systems for bacterial physiology. TA systems consist of a toxin and an antitoxin protein; when expressed, the toxin kills the bacterium. In typical bacterial physiology, the antitoxin binds to the toxin and neutralises it, hence preventing the suicide of the bacterium. The toxin protein is always stable, whereas the antitoxin is unstable. The unstable nature of the antitoxin makes it highly susceptible to proteolytic degradation. When the antitoxin is degraded or not functional, the toxin produced kills the bacterium, which is known as programmed cell death (Cherny 2007). Thus, this system has recently gained attention, especially as a target for antimicrobial agents. However, the presence and type of TA system vary from bacterium to bacterium. TA systems can be either plasmid encoded or chromosomally mediated. In plasmid-mediated systems, if the plasmid is lost during cell division, the antitoxin protein rapidly degrades and is not replenished. The stable toxin is thus released, killing the bacterial cell (Gerdes 1986, Gerdes et al. 2005).

In the present investigation, we aimed to screen for different TA systems in Acinetobacter baumannii. Acinetobacter species are top ranking among nosocomial pathogens with multiple drug-resistant strains. These species cause various nosocomial infections, such as bacteraemia, urinary tract infection, secondary meningitis, surgical site infection and nosocomial and ventilator-associated pneumonia (Go et al. 1994). The management of Acinetobacter infections is always challenging, especially in intensive care units, with many mortality reports. Identifying the types of TA systems, whether they are functional and their location in A. baumannii will provide a fundamental understanding of their application as antibiotic targets.

Eighty-five unique multidrug-resistant A. baumannii isolates isolated from different clinical sources in Malaysia were investigated. All isolates were subjected to amplification of the mazEF, relBE and higBA TA genes within chromosomal and plasmid DNA using primers designed based on the corresponding gene sequence in the gene bank (Table I). Polymerase chain reaction (PCR) amplification was performed in a DNA thermal cycler (Bio-Rad) using the amplification parameters described previously (Moritz & Hergenrother 2007), with a lowering of the annealing temperature to 58ºC. The PCR-amplified products were analysed by agarose gel electrophoresis. To identify whether the TA systems were encoded in plasmid or chromosomal DNA, PCR amplification for all isolates was conducted individually with plasmid and chromosomal DNA. To assess functionality, reverse transcriptase (RT)-PCR was performed using the SuperScript One-Step RT-PCR System with Platinum Taq (Invitrogen). The reverse transcription and PCR amplification were conducted in a DNA thermal cycler (Bio-Rad) under the reaction conditions described previously (Moritz & Hergenrother 2007), using the primers used for the conventional PCR described above. The RT-PCR amplification products were analysed by agarose gel electrophoresis.

TABLE I. Gene-specific primers used for polymerase chain reaction (PCR) and reverse transcriptase-PCR analysis.

Toxin-antitoxin systems Primer sequences Length
mazEF Forward: ACCTTCGAAGGAACTACGTCAGTAG Reverse: ATAGGCGAACATGCAAGAAAAGGCAGC 436 bp
relBE Forward: ATGAAGTGAACGGTCAACAATA Reverse: ACAGACCTCGGAAAGTGGTCG 578 bp
higBA Forward: AGCACATCCGTACGATCTACTGC-3 Reverse: TGCACTCCTGCGATGCGGCGAA 440 bp

The results of screening chromosomal DNA for the presence of different TA loci showed that all A. baumannii isolates (85/85, 100%) were positive for mazEF and that relBE was found in 88.2% of isolates (75/85), whereas higBA (4/85, 4.7%) was less prevalent (Table II). PCR analysis of plasmid DNA did not yield any positive amplification, indicating that in A. baumannii, the screened TA systems were chromosomally mediated. To confirm the functionality of the TA systems, all clinical isolates containing TA systems were subjected to RT-PCR. RNA from all isolates was collected and subjected to cDNA synthesis. PCR was then performed to confirm the functionality of the TA systems. The positive results confirmed the functionality of the TA systems.

TABLE II. Prevalence of different toxin-antitoxin loci in Acinetobacter baumannii .

Isolates mazEF higBA relBE RT-PCR results of mazEF RT-PCR results of higBA RT-PCR results of relBE
1 + - - + - -
2 + - + + - +
3 + - + + - +
4 + - + + - +
5 + - + + - +
6 + - + + - +
7 + - + + - +
8 + - + + - +
9 + - - + - -
10 + - + + - +
11 + - + + - +
12 + + + + + +
13 + - + + - +
14 + - + + - +
15 + - + + - +
16 + - + + - +
17 + - - + - -
18 + - - + - -
19 + - + + - +
20 + - + + - +
21 + + + + + +
22 + + + + + +
23 + - + + - +
24 + - + + - +
25 + - + + - +
26 + - + + - +
27 + - + + - +
28 + - + + - +
29 + - + + - +
30 + - + + - +
31 + - + + - +
32 + - - + - -
33 + - + + - +
34 + - + + - +
35 + - + + - +
36 + - + + - +
37 + - + + - +
38 + - + + - +
39 + - + + - +
40 + - - + - -
41 + - + + - +
42 + - + + - +
43 + - + + - +
44 + - + + - +
45 + + + + + +
46 + - + + - +
47 + - - + - -
48 + - - + - -
49 + - + + - +
50 + - + + - +

TA system transcripts were detected from the total RNA of all A. baumannii strains probed by RT-PCR. The results of the RT-PCR strongly indicated that the TA systems are functional in all A. baumannii. To control for the contamination of any reaction with DNA, a reaction without the RT enzyme, but including the other materials, was used. The negative results confirmed that no contamination of the DNA had occurred. In a study on Escherichia coli and the cyanobacterium Anabaena by Ning et al. (2013), similar results were obtained, which showed the functionality of the mazEF TA system. Moritz and Hergenrother (2007) demonstrated the functionality of mazEF using RT-PCR by evaluating 10 vancomycin resistance enterococcus (VRE) isolates and found that mazEF TA loci were transcribed in all 10 VRE isolates. We used PCR as a tool to screen for different TA systems in A. baumannii and found that mazEF TA loci were frequently present.

Identifying TA systems in clinical isolates is important for validating these systems as antibacterial targets. In the current study, RT-PCR analysis was performed to determine whether the TA systems were transcribed. RT-PCR showed that the mazEF, higBA and relBE TA systems were functional in all strains positive for TA loci.

It has been suggested that by activating TA systems (disrupting antitoxin or causing increased toxin expression), it is possible to find a new sensitive target in A. baumannii (Engelberg-Kulka et al. 2004, Gerdes et al. 2005, Williams & Hergenrother 2008). Unfortunately, no previous study has examined the prevalence of TA systems in a large panel of clinical isolates of A. baumannii. In addition, this is the first time that the mazEF, higBA and relBE transcripts have been shown to be present in A. baumannii and one of the few examples demonstrating the transcription of any TA loci in a clinical isolate.

The current research indicated that TA systems are prevalent, harboured by chromosomes and transcribed in clinical isolates of A. baumannii.

REFERENCES

  1. Cherny I. Structural and thermodynamic characterization of the Escherichia coli RelBE toxin-antitoxin system: indication for a functional role of differential stability. Biochemistry. 2007;46:12152–12163. doi: 10.1021/bi701037e. [DOI] [PubMed] [Google Scholar]
  2. Davies J, Webb V. Krause RM. Emerging infections: biomedical research reports. Academic Press; San Diego: 1998. Antibiotic resistance in bacteria; pp. 239–273. [Google Scholar]
  3. Engelberg-Kulka H, Sat B, Reches M, Amitai S, Hazan R. Bacterial programmed cell death systems as targets for antibiotics. Trends Microbiol. 2004;12:66–71. doi: 10.1016/j.tim.2003.12.008. [DOI] [PubMed] [Google Scholar]
  4. Gerdes K. Unique type of plasmid maintenance function: postsegregational killing of plasmid-free cells. Proc Natl Acad Sci USA. 1986;83:3116–3120. doi: 10.1073/pnas.83.10.3116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Gerdes K, Christensen SK, Lobner-Olesen A. Prokaryotic toxin-antitoxin stress response loci. Nat Rev Microbiol. 2005;3:371–382. doi: 10.1038/nrmicro1147. [DOI] [PubMed] [Google Scholar]
  6. Ghafourian S, Raftari M, Sadeghifard N, Sekawi Z. Toxin-antitoxin systems: classification, biological function and application in biotechnology. Curr Issues Mol Biol. 2014;16:9–14. [PubMed] [Google Scholar]
  7. Go ES, Urban C, Burns J, Kreiswirth B, Eisner W, Mariano N. Clinical and molecular epidemiology of acinetobacter infections sensitive only to polymyxin B and sulbactam. Lancet. 1994;12:1329–1332. doi: 10.1016/s0140-6736(94)90694-7. [DOI] [PubMed] [Google Scholar]
  8. Moritz EM, Hergenrother PJ. Toxin-antitoxin systems are ubiquitous and plasmid-encoded in vancomycin-resistant enterococci. Proc Natl Acad Sci USA. 2007;104:311–316. doi: 10.1073/pnas.0601168104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ning D, Jiang Y, Liu Z, Xu Q. Characterization of a chromosomal type II toxin-antitoxin system mazEaFa in the cyanobacterium Anabaena sp. PCC 7120. e56035PLoS ONE. 2013;8 doi: 10.1371/journal.pone.0056035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Schlessinger D, Eisenstein B. Schaechter M, Engleberg NC, Eisenstein B, Medoff G. Biological basis for antibacterial action. 3rd. Williams & Wilkins; New York: 1999. Biological basis for antibacterial action; pp. 52–60. [Google Scholar]
  11. Williams JJ, Hergenrother PJ. Exposing plasmids as the Achilles’ heel of drug-resistant bacteria. Curr Opin Chem Biol. 2008;12:389–399. doi: 10.1016/j.cbpa.2008.06.015. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Memórias do Instituto Oswaldo Cruz are provided here courtesy of Instituto Oswaldo Cruz

RESOURCES