Table 1. Primers used to detect MNV by RT-nested PCR.

Primer		Sequence (5’ to 3’)	Polarity1)	Positions2)
1st PCR	MNoVorf1&2-F5	CGCTTYGGAACRATGGATGCTG	+	5001 − 5022
	MNoVorf1&2-R2	AGCCRGTRTACATGGCTGAG	−	5340 − 5359
2nd PCR	MNoVorf1&2-F6	CGCAGGAACGCTCAGCAGTC	+	5029 − 5048
	MNoVorf1&2-R3	CRAGRTARGGGTTRAGYCCYG	−	5312 − 5332

¹⁾+, sense; −, anti-sense. ²⁾Nucleotide positions correspond to those of the MNV S7 complete genome (AB435514).