. 2013 Dec 17;4(5):545–551. doi: 10.1007/s13205-013-0190-9

Table 1.

Primers used for screening of Bt isolates for different cry and ps genes

Primer sequences	Annealing °C	Gene	Amplicon size (bp)	Primer position in ORF		Reference
Primer sequences	Annealing °C	Gene	Amplicon size (bp)	FP	RP	Reference
F: CATGATTCATGCGGCAGATAAAC	62	cry1	278	2,783	3,060	Ben-Dov et al. (1997)
R: TTGTGACACTTCTGCTTCCCATT	62	cry1	278	2,783	3,060	Ben-Dov et al. (1997)
F: GTTATTCTTAATGCAGATGAATGGG	64	cry2	702	570	1,271	Ben-Dov et al. (1997)
R: CGGATAAAATAATCTGGGAAATAGT	64	cry2	702	570	1,271	Ben-Dov et al. (1997)
F: ATCAAGAATTTTCCGATAATC	50	ps1	1,136	154	1,289	Yasutake et al. (2007)
R: CCAAAAGTGCCAGAATG	50	ps1	1,136	154	1,289	Yasutake et al. (2007)
F: TGTTGGGACTGTTCAGTACGT	56	ps2	503	341	843	*
R: CGTCACGGTACCTCTTAGTGT	56	ps2	503	341	843	*
F: GGAATCCAGGTGCACTGCT	67	ps3	701	264	964	*
R: GTCCCGGATCATACGTTGGA	67	ps3	701	264	964	*
F: AGTGGTCTCCAGGCTCATACTGG	59	ps4	681	81	761	*
R: TGATATTCCCGAACCTGCCCT	59	ps4	681	81	761	*

* Designed in this study using Fast PCR 6.0