Skip to main content
. 2014 Sep 16;3:e03164. doi: 10.7554/eLife.03164

Figure 1. eEF1A1 regulates HSP70 expression and thermotolerance.

(A) Knock down of eEF1A1 decreases HSP70 protein expression upon heat shock. Western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of MDA-MB231 cells transfected with siRNA (pair A) against eEF1A1 or HSF1, or mock-transfected (Si:NT with no target). Control (C)—unstressed cells kept at 37°C. Heat shock (HS)—cells kept for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (B) HSF1- or eEF1A1-knocked down cells are less thermo-tolerant. Cell death was quantified by FACS analysis after propidium iodide staining. Thermotolerance was induced in mock-transfected (Si:NT) or eEF1A1/HSF1-depleted cells by two heat treatments (1 hr at 43°C, 12 hr at 37°C, and 1 hr at 45°C), followed by 12 hr of recovery. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05. (C) Knock down of eEF1A1 decreases HSP70 mRNA expression during heat shock. Total RNA from heat shocked MDA-MB231 cells was reverse-transcribed with random hexamer primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP70 mRNA in cells depleted of eEF1A1 relative to that obtained for mock-transfected cells (Si:NT). 1 is the value of HSP70 mRNA in Si:NT cells at 1 hr of heat shock. Data from three independent experiments are presented as the mean ± SEM. *p < 0.05. (D) eEF1A1 controls RNAPII occupancy at the HSP70 gene after stress as determined by ChIP-QPCR. Schematic of the HSPA1A locus is shown at the top. Arrowheads indicate the regions amplified by QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1) on RNAPII occupancy relative to input Ct value under non-heat shock conditions (control) and after 30 min of heat shock. The relative value for the IgG is indicated for each of the PCR fragments on top of the plot. Values below that of the IgG mean non-specific binding. Mock-transfected cells (Si:NT). By comparison, GAPDH showed no change with si;eEF1A1. Data from three independent experiments are presented as the mean ± SEM. (*p < 0.05). (E) eEF1A1 mediates HSP70 transcription upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 30 min after HS, cells were fixed and HSP70 mRNA detected by FISH. Nuclei were stained with DAPI. Merged images show Cherry-eEF1A1 in red, HSP70 TS in gray and nucleus in blue. White arrows indicate cells knocked down of eEF1A1. Bar = 10 microns. (F) eEF1A1 mediates HSP70 transcription upon HS. Plots are the quantification of the intensity of HSP70 transcription, per cell or per TS, detected by FISH and quantified by airlocalize. A total of seventy cells per condition were analyzed from three independent experiments. NT = non-transfected cells. eEF1A1 = cells transfected with siRNA for eEF1A1.

DOI: http://dx.doi.org/10.7554/eLife.03164.003

Figure 1.

Figure 1—figure supplement 1. Knock down of eEF1A1 does not affect general translation or cell viability.

Figure 1—figure supplement 1.

(A) Knock down of HSF1 or eEF1A1 by DsiRNA does not affect overall protein synthesis. Pulse-chase experiment with [35S]-methionine in mock transfected cells (−), or cells knocked down for HSF1 (H), or eEF1A1 (E). Cells were kept at 37°C (C) or heat-shocked for 45 min at 40°C followed by a 30 min incubation at 40°C with 50 μCi/ml of [35S] (HS). Numbers at the left indicate molecular weight in kDa. (B) Inhibition of HSF1 or eEF1A1 does not affect normal cell growth. Quantification of cell viability by the MTT assay was performed on mock-transfected cells (Si:NT) or cells depleted of eEF1A1 or HSF1 under normal cell growth conditions. ns = Non significant differences with Si:NT cells.
DOI: http://dx.doi.org/10.7554/eLife.03164.004
Figure 1—figure supplement 2. eEF1A1 regulates HSP70 expression (all experiments in this figure were done with an alternative pair of siRNAs [pair B] to rule out off-target effects).

Figure 1—figure supplement 2.

(A) Knock down of eEF1A1 decreases HSP70 protein expression upon heat shock. Western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of MBS-MEF cells transfected with siRNA (pair B) against eEF1A1 or mock-transfected (Si:NT with no target). Control (C)—unstressed cells kept at 37°C. Heat shock (HS)—cells kept for 1 hr at 43°C followed by 2 hr of recovery (short induction) or 6 hr of recovery (long induction) at 37°C. Low panels—ponceau staining of the membranes. Numbers indicate molecular weight. Plots show the relative fluorescence intensity of bands as compared to mock-transfected non-stressed cells. (B) Knock down of eEF1A1 decreases HSP70 mRNA expression during HS. Total RNA from heat shocked MDA-MB231 cells was reverse-transcribed with random hexamer primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP70 mRNA in cells depleted of eEF1A1 relative to that obtained for mock-transfected cells (Si:NT). 1 is the value of HSP70 mRNA in Si:NT cells at 1 hr of heat shock. Data from three independent experiments are presented as the mean ± SEM, *p < 0.05. (C) eEF1A1 controls RNAPII occupancy at the HSP70 promoter after stress as determined by ChIP-QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1) on RNAPII occupancy relative to the input Ct value after 30 min of heat shock. The relative value for the IgG is indicated for each of the PCR fragments on top of the plot. Values below that of the IgG mean non-specific binding. Mock-transfected cells (Si:NT). Data from two independent experiments are presented as the mean ± SEM. (D) eEF1A1 mediates HSP70 transcription upon HS. MEFs were infected with a lentivirus expressing Cherry-eEF1A1. eEF1A1 expression was knocked down by siRNA. At 30 min after HS cells were fixed and HSP70 mRNA detected by FISH. Nucleus stained with DAPI. Yellow arrows indicate TS. Bar = 10 microns. (E) eEF1A1 mediates HSP70 transcription upon HS. Plots are the quantification of the intensity of HSP70 transcription, per cell or per TS, detected by FISH and quantified by airlocalize. A total of 25 cells per condition were analyzed from three independent experiments. NT = non-transfected cells. eEF1A1 = cells transfected with siRNA for eEF1A1.
DOI: http://dx.doi.org/10.7554/eLife.03164.005
Figure 1—figure supplement 3. Knock down of eEF1A1 reduces HSPs expression in mouse and human cells.

Figure 1—figure supplement 3.

(A) Knock down of eEF1A1 decreases the production of HSP70 in NSC-34 cells (mouse neuroblastoma/spinal cord fusion cell line). The panel indicates expression of eEF1A1 and HSP70 normalized to GAPDH in heat-shocked samples transfected with eEF1A1 siRNAs and the scrambled non-targeting negative control. Two different RNAi were used to inhibit eEF1A1 isoform (pair C): 1A1-a UGACAAUCCAGAACAGGAGCGUAGC; 1A1-b AAGUGGAGGGUAGUCAGAGAAGCUC. Cells were transfected with separate siRNAs (Invitrogen) using siLentFect (Bio-Rad), allowed to recover for 24 hr, incubated at 43°C for 2 hr, and then recovered again for 16 hr. Control cells remained at 37°C for the duration of the experiment. Western-blots were analyzed separately for each siRNA and the values related to those of scrambled control. Data are the mean ± SEM is from three independent experiments. (B) Knock down of eEF1A1 suppresses HSP70 protein induction upon heat shock. The panels show western blots of HSP70, eEF1A1, HSF1, and GAPDH from total cell lysates of WI38 human fibroblast cells mock-transfected (Si:NT) or knocked down of eEF1A1. Cells were heat-shocked for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (C) Knock down of eEF1A1 decreases HSP27 protein induction upon heat shock. The panels show SDS-PAGE and immunoblots of HSP27, eEF1A, and GAPDH from total cell lysates of mock-transfected (Si:NT) MDA-MB231 cells or cells depleted of eEF1A. Cells were heat-shocked for 1 hr at 43°C followed by 6 hr of recovery at 37°C. (D) Knock down of eEF1A1 diminishes HSP70 mRNA expression during heat shock. Total RNA from heat-shocked WI38 cells was reverse-transcribed with random primers followed by quantification of GAPDH and HSP70 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the mean ± SEM amount of HSP70 mRNA from three different experiments in cells depleted of eEF1A1 relative to that detected in mock-transfected cells (Si:NT = 1). *p < 0.05. (E) Knock down of eEF1A1 diminishes HSP27 mRNA expression during heat shock. Total RNA from heat-shocked MDA-MB-231 cells was reverse-transcribed with random primers followed by quantification of GAPDH and HSP27 mRNAs by QPCR. HSP70 mRNA values were normalized to that of GAPDH. Bars represent the mean ± SEM amount of HSP27 mRNA in cells depleted of eEF1A1 relative to that detected in mock-transfected cells (Si:NT = 1). *p < 0.05. (F) eEF1A1 controls transcription of various heat shock genes. Knock down of eEF1A1 compromises mRNA induction of several major heat-shock genes during heat shock. Total RNA from heat-shocked or unstressed MDA-MB231 cells was reverse-transcribed with random primers followed by quantification of GAPDH and the indicated mRNAs by QPCR. mRNA values were normalized to that of GAPDH. Bars represent the amount of HSP mRNAs in cells inhibited of eEF1A1 relative to that in mock-transfected cells (Si:NT = 1) at 2 hr of heat shock. Means ± SEM are from three independent experiments. *p < 0.05. (G) Role of eEF1A1 in HSR is independent of its role in translation elongation. Quantification of induction of HSP70 mRNA by RT-QPCR after 1 hr of heat shock or treatment with the translation inhibitors cycloheximide (CHX, 50 μg/ml) or doxycycline (DOX, 5 μg/ml) in mock transfected cells or cells knocked down of eEF1A. Data are the mean ± SEM comparing mock transfected with Si:eEF1A1. *p < 0.05 and **p < 0.01.
DOI: http://dx.doi.org/10.7554/eLife.03164.006
Figure 1—figure supplement 4. eEF1A2 does not support HSR.

Figure 1—figure supplement 4.

(A) eEF1A1, but not eEF1A2, mediates HSP70 induction upon heat shock. The levels of HSP70 mRNA with respect to GAPDH were determined by RT-QPCR after 1 hr of heat shock in mock-transfected cells (si: nt) or cells knocked down of eEF1A1 or eEF1A2. The HSP70 mRNA level is taken as 100% in mock transfected cells. Data are the mean ± SEM from three experiments. *p < 0.05. (B) Knocking down eEF1A2, does not decrease HSP70 protein induction in NSC-34 cells (mouse neuroblastoma/spinal cord fusion cell line). Panel indicates expression of eEF1A2 and HSP70 normalized to GAPDH in heat-shocked samples transfected with eEF1A2 siRNAs and the scrambled non-targeting negative control. Two different RNAi were used to inhibit eEF1A2 isoform: 1A2-a UUAACGGACACAUUCUUCACAUUGA; 1A2-b CAAUCUUGUACACAUCCUGCAGAGG. Cells were transfected with separate siRNAs (Invitrogen) using siLentFect (Bio-Rad), allowed to recover for 24 hr, incubated at 43°C for 2 hr, and then recovered again for 16 hr. Control cells remained at 37°C for the duration of the experiment. Western-blots were analyzed separately for each siRNA and the values related to those of scrambled control. Data are the mean ± SEM is from three independent experiments. (C) Motor neurons express eEF1A2, but not eEF1A1. Immunofluorescence imaging of eEF1A1 (red) and eEF1A2 (green) in the mouse spinal cord shows non-overlapping cytoplasmic staining. eEF1A2 is present only in motor neurons (white arrow). eEF1A1 is present only in smaller interneurons and white matter (glia cells) (yellow arrow). Right panel shows the magnified area (white box in left image). Images were captured at 40x magnification.
DOI: http://dx.doi.org/10.7554/eLife.03164.007
Figure 1—figure supplement 5. Knock down of eEF1A1 decreases overall transcription of HSP70.

Figure 1—figure supplement 5.

(A) Schematic of the HSPA1A locus is shown at the top. Plot shows the occupancy of RNAPII relative to input Ct value in eEF1A1 depleted (Si:eEF1A1) and mock-transfected human fibroblast WI38 cells (Si:NT) as determined by ChIP-QPCR. The values for the IgG control are indicated for each PCR fragment. Media ± SEM values lower than those numbers mean no occupancy. (B) Nuclear run-on analysis of HSPA1A and GAPDH transcription in heat shocked (43°C, 20 min) control fibroblasts (NT) or eEF1A1-knocked down cells (eEF1A1) with two unrelated siRNAs (pair A or pair B). Numbers on the left represent the hybridization probe position. Numbers on the right represent % of run-on transcripts in eEF1A1-knocked down cells as compared to mock-transfected cells. (C) eEF1A1 controls RNAPII occupancy at the HSP70 promoter after stress as determined by ChIP-QPCR. Panels show the effect of eEF1A1 knock down (si:eEF1A1 [pair B]) on RNAPII occupancy relative to the input Ct value under non-HS conditions (C) or after 30 min of heat shock (HS) on HSP70 and GAPDH promoters. Mock-transfected cells (Si:NT). Data from two independent experiments are presented as the mean ± SEM.
DOI: http://dx.doi.org/10.7554/eLife.03164.008
Figure 1—figure supplement 6. Characterization of MEFS expressing Cherry-Flag-eEF1A1.

Figure 1—figure supplement 6.

(A) Panels show Western blots of eEF1A1, Flag and GAPDH from total cell lysates of immortalized MEFs (Lionnet et al., 2011) infected with a lentivirus expressing eEF1A1 fused to Cherry and Flag on its N terminus. Wt indicate non-infected cells, sorted are cells sorted to get a homogenous population expressing cherry-eEF1A. Image shows the expression of Cherry-eEF1A1 by fluorescence microscopy after fixation. (B) Percentage of cells with active TS for HSP70 detected by FISH. Data represent median ± SEM from four independent experiments. Time in minutes indicate the length MEF cells were at 43°C before fixation and FISH. TS were counted after microscopy. (C) Percentage of TS for HSP70 detected by FISH. Date represent media ± SEM from four independent experiments. Time in minutes indicate the length MEF cells were heated at 43°C before fixation and FISH.
DOI: http://dx.doi.org/10.7554/eLife.03164.009